ID: 1195051955

View in Genome Browser
Species Human (GRCh38)
Location X:101105221-101105243
Sequence CTTAAAACATATATGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195051948_1195051955 -7 Left 1195051948 X:101105205-101105227 CCCACTCCCATCTCACCTTAAAA 0: 1
1: 0
2: 3
3: 41
4: 643
Right 1195051955 X:101105221-101105243 CTTAAAACATATATGGAGTAGGG 0: 1
1: 0
2: 3
3: 18
4: 247
1195051949_1195051955 -8 Left 1195051949 X:101105206-101105228 CCACTCCCATCTCACCTTAAAAC 0: 1
1: 0
2: 1
3: 29
4: 345
Right 1195051955 X:101105221-101105243 CTTAAAACATATATGGAGTAGGG 0: 1
1: 0
2: 3
3: 18
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195051955 Original CRISPR CTTAAAACATATATGGAGTA GGG Intronic
902088916 1:13886825-13886847 CTTACAACATCTGTGAAGTAAGG - Intergenic
907099474 1:51815569-51815591 CATATAACATATATTGTGTAAGG + Intronic
907343085 1:53751063-53751085 CCAAATGCATATATGGAGTAAGG + Intergenic
908829428 1:68164575-68164597 CATAAAAAATACATGAAGTAGGG + Intronic
909648636 1:77947807-77947829 ATTGAAACATAAATGGGGTATGG - Intronic
909829185 1:80164169-80164191 ATTAAAACACATATGGCATAAGG - Intergenic
910644543 1:89499278-89499300 CTTAAACCATGTATGCAGGAAGG + Intergenic
911268568 1:95773463-95773485 CTTAAAACACAATTGGAATAAGG + Intergenic
911444214 1:97970583-97970605 CTTAAAACCTATGTAGAGCAAGG - Intergenic
915426432 1:155830878-155830900 CTTAAAAAATATTTGGGGTCAGG - Intronic
915874319 1:159596122-159596144 CTATAAACATATTTGGAGTAGGG - Intergenic
917488483 1:175476956-175476978 CTTAAAACATAGTTAGAGGAAGG - Intronic
917659875 1:177167025-177167047 CTTAAAATGTATATTGAGTTGGG + Intergenic
917767577 1:178239128-178239150 CTAAAAACATAGATAGAATAGGG - Intronic
919078850 1:192846047-192846069 AATAAAACAAATATAGAGTAGGG - Intergenic
920410218 1:205753357-205753379 GTCAAAACATATATGGAGCCGGG - Intergenic
920581081 1:207108596-207108618 CTTAAAACTTACACGGAGGAAGG + Intronic
1063353675 10:5378568-5378590 TTTAAAATATATATGGAGATGGG - Intergenic
1064780146 10:18828061-18828083 CTTAAAATGTATTTGGAGAATGG - Intergenic
1068341524 10:55710585-55710607 TTTAAAAGATATCTGGACTATGG + Intergenic
1068456920 10:57267427-57267449 CTTCAAACATATGTAGATTAAGG - Intergenic
1069947469 10:71997960-71997982 CTTAAATCATTTATGGAGACTGG - Intronic
1070416234 10:76192023-76192045 GGGAAAACATCTATGGAGTAGGG + Intronic
1070645619 10:78200188-78200210 ATTGACACATATTTGGAGTAAGG + Intergenic
1073203816 10:101757792-101757814 CTTAAAACATTTATATAGTGTGG + Intergenic
1074058798 10:109946082-109946104 CTTATAACATATATGGCACATGG - Intronic
1079924523 11:26477415-26477437 CTAAAAACATGAATGGAGAAAGG - Intronic
1080798085 11:35584094-35584116 CTGAAAGCACCTATGGAGTAGGG + Intergenic
1082954647 11:58857025-58857047 CTTTAAACATATATGCAGTAGGG + Intronic
1082971700 11:59029716-59029738 CTTTAAACATATATGCAGTAGGG + Intronic
1084626261 11:70310029-70310051 TTTAAAACATAAAAGCAGTATGG + Intronic
1085679449 11:78558667-78558689 CTTAAAAAATATCTGCAGTAAGG + Intronic
1086574188 11:88319629-88319651 CTTAAAATATATTTTGGGTAGGG + Intronic
1087790134 11:102397133-102397155 TGTAACACATACATGGAGTATGG - Exonic
1088691524 11:112332699-112332721 CTGAAAACATATAAAGAGAAAGG - Intergenic
1089219901 11:116861926-116861948 CCTAAAACATATATGGGGAAAGG + Exonic
1092484391 12:8889896-8889918 CTTAAAACTGATAGGGAGGAAGG + Intergenic
1094731907 12:33186445-33186467 CATAAAACATATATGGTCTCAGG + Intergenic
1095579675 12:43783061-43783083 CTTAGAACATATGTTGAGTGGGG + Intronic
1096606596 12:52770957-52770979 CTAAAACCATATCTGGAGAATGG + Intronic
1096668553 12:53183604-53183626 TTTAAATTATATATGGAGCAAGG + Intronic
1096949441 12:55450971-55450993 GTTAAAGCATAAATTGAGTAGGG + Intergenic
1101609812 12:106280183-106280205 CTTTAAAAATAAATGGGGTAAGG + Intronic
1102616040 12:114155064-114155086 CTTAAAAGGTATATGGAAGAAGG + Intergenic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1105438844 13:20399532-20399554 CTAAACACATATATTGAATAAGG + Intergenic
1105643661 13:22292794-22292816 ATTCAAACATAAATTGAGTATGG - Intergenic
1108423459 13:50273903-50273925 CATAATAAATATATGCAGTAAGG - Intronic
1108725657 13:53177874-53177896 CATAAGACAAATATGGAATATGG + Intergenic
1108967972 13:56336257-56336279 CATAGAAAATATATGAAGTATGG + Intergenic
1109734017 13:66457185-66457207 CTTAAACTTTATATGGATTATGG + Intronic
1111149171 13:84226107-84226129 CTGATAACATATATGGATTGAGG + Intergenic
1112067667 13:95811851-95811873 ATTAAAAAATAAAGGGAGTATGG + Intronic
1114594642 14:23900839-23900861 ATGAAAACATATATAGAGCAAGG - Intergenic
1115319110 14:32059447-32059469 CTTCAAAAATATACTGAGTAGGG - Intergenic
1116149690 14:41125092-41125114 CTTAAAACATATATTTAAAATGG - Intergenic
1116599986 14:46908741-46908763 CTTAAAAACTATATGAGGTAAGG - Intronic
1118127041 14:62917300-62917322 CTTTAAAGATAAATTGAGTAGGG - Intronic
1119094683 14:71818191-71818213 CTGAAAAAATATATGTAGCAAGG - Intergenic
1120788768 14:88560396-88560418 ATTAAAACATATTCAGAGTAGGG - Intergenic
1124446761 15:29741233-29741255 TTTAAAAAATATATGCAATATGG + Intronic
1124500124 15:30221008-30221030 CTTAAGAATTATCTGGAGTAGGG + Intergenic
1124743451 15:32317658-32317680 CTTAAGAATTATCTGGAGTAGGG - Intergenic
1124946867 15:34276801-34276823 TGTAAAACATATGTGGACTATGG - Intronic
1125388976 15:39171741-39171763 TTTAACACATATATGAAGTGGGG + Intergenic
1125612178 15:40979109-40979131 TTTAAAACTTTTTTGGAGTAGGG - Exonic
1127173334 15:56327393-56327415 CTTAAAAGATATAAACAGTATGG + Intronic
1130404448 15:83585362-83585384 CTTGAAACATATTTGGGGTTGGG - Intronic
1131749021 15:95485795-95485817 AATAAAACATAAATTGAGTAGGG - Intergenic
1133676169 16:8074939-8074961 AGAAAAACATATATGGAGTTCGG - Intergenic
1139704890 16:68734465-68734487 CTCAATAAATATTTGGAGTAGGG - Intergenic
1140615687 16:76660371-76660393 CTTTCAAAATATATGGATTAGGG - Intergenic
1140906265 16:79411888-79411910 CTTTAAAAACATATGTAGTAGGG + Intergenic
1147351216 17:39846119-39846141 CTTAAAACATATCAGGAGATTGG - Intronic
1149214391 17:54337041-54337063 CTTAAAATATATATTGTGTTTGG + Intergenic
1151288353 17:73129935-73129957 CTTAAAAAAAAAATGAAGTAAGG - Intergenic
1152476025 17:80518743-80518765 CCCAACACATATATGGAGGATGG - Intergenic
1152826884 17:82471934-82471956 ATTAATTTATATATGGAGTAAGG + Intronic
1155009642 18:21764151-21764173 CATAAAACATATTTGGTGTTGGG + Intronic
1155767538 18:29653638-29653660 CTGAAACCATATATGCATTAGGG - Intergenic
1156110608 18:33721710-33721732 TTTAAAACTTATTTGGAGGAAGG + Intronic
1157429267 18:47611204-47611226 CTTAAAAAATATCTGGAGGATGG - Intergenic
1157721715 18:49930421-49930443 TTTTAAACATATATTGAGTATGG + Intronic
1157939951 18:51917637-51917659 CTGAAAAAATATTTGGAGTGGGG + Intergenic
1159159896 18:64630542-64630564 CTTAAAACATATATGAACAAAGG + Intergenic
1159719891 18:71875451-71875473 ATAAAAACACATATGGAGGACGG + Intergenic
1159964014 18:74578761-74578783 GTTTACACATAGATGGAGTAGGG + Intronic
1164681640 19:30137822-30137844 ATTAAAACATACATGGAATTAGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166451072 19:42901186-42901208 CTTAAAAAATAAATGAAGTGTGG + Intronic
1167488114 19:49775220-49775242 TTTAAAAAATATATGGAGACAGG - Intronic
925560336 2:5184699-5184721 TTTAAAACATTTTTTGAGTAAGG - Intergenic
926211880 2:10877423-10877445 CTTAATAAATATATTGATTAAGG - Intergenic
926407054 2:12565247-12565269 TTTAAAACAAATAGGAAGTAGGG + Intergenic
926893975 2:17663806-17663828 CTTAAAATTTATATGTATTAAGG - Exonic
927327223 2:21818989-21819011 AATAAAACATATATGGTTTAGGG + Intergenic
928126026 2:28617142-28617164 TTAAAAACATATAAGGAATAAGG + Intronic
931518067 2:63063692-63063714 TTTAAACCAGATATGGAGTTGGG + Intergenic
936751611 2:115648901-115648923 CTTAATAGATTAATGGAGTAGGG + Intronic
938635336 2:133219386-133219408 CTTAAAACAATTACGGAGCATGG - Intronic
938940235 2:136163349-136163371 TTTAAAACATATATAGATTCAGG - Intergenic
939047062 2:137262155-137262177 CATAAAGCATTTATAGAGTAGGG + Intronic
939902434 2:147866579-147866601 CTTAAGGCATATATGGGGGATGG + Intronic
942628178 2:177926182-177926204 CTTAAAGCATATATTGAGAATGG - Intronic
943044599 2:182844909-182844931 TTTAAAATATATATTTAGTATGG - Intronic
943434388 2:187846408-187846430 CTTAAAACAGAAATGAAGAAAGG + Intergenic
943999325 2:194812047-194812069 AATAAAAGATATATGGATTATGG + Intergenic
944027445 2:195188219-195188241 ATAAAAACATATATGGAATGAGG - Intergenic
945536995 2:211029298-211029320 TTAAAAACAAATATGGAGTATGG + Intergenic
946426448 2:219600512-219600534 CTTAAAAAATATAATAAGTATGG - Intronic
946631414 2:221673048-221673070 CTTAAAAATAACATGGAGTAGGG - Intergenic
1168937270 20:1676171-1676193 CCTTAAACATAGATGGAGAAGGG - Intergenic
1170308745 20:14969847-14969869 CTTTAAACATAAATGAATTATGG + Intronic
1170669746 20:18420791-18420813 CTTAATACATGTTTGTAGTATGG - Intronic
1171724109 20:28599776-28599798 CTTAAAAAATATATAAAATATGG - Intergenic
1171753949 20:29083257-29083279 CTTAAAAAATATATAAAATATGG + Intergenic
1171788294 20:29494271-29494293 CTTAAAAAATATATAAAATATGG - Intergenic
1171859256 20:30380249-30380271 CTTAAAAAATATATAAAATATGG + Intronic
1173508744 20:43609312-43609334 CCAAAAACATATATGGAGGGTGG + Intronic
1174159737 20:48542327-48542349 ATTTCAACATATATGGAGTCAGG + Intergenic
1175478141 20:59291562-59291584 CTGGTAACATATATGCAGTACGG + Intergenic
1177582173 21:23038775-23038797 CTTAAAACTTATATGGTGTATGG - Intergenic
1178254025 21:31034239-31034261 TTTAAAACAGAAATGGAGCAAGG + Intergenic
1178399207 21:32269792-32269814 CCTAAAACATAACTGAAGTACGG + Exonic
1178686803 21:34718274-34718296 CTTGAAACCTAAATGGAGAATGG - Intergenic
1179093619 21:38291595-38291617 CTTAAAAGTTATCTGGAATATGG - Intronic
1179528502 21:42000721-42000743 ATGAAAACATCTATGGACTAGGG + Intronic
1180297661 22:10958452-10958474 CTTAAAAAATATATAAAATATGG - Intergenic
950335936 3:12193003-12193025 CTTAAAACATATTTGGAATCGGG - Intergenic
950383527 3:12637573-12637595 CTTAAAACACAAATGGAGGCCGG + Intronic
950537411 3:13587184-13587206 ATAAAAACACATATAGAGTAAGG + Intronic
951487342 3:23228465-23228487 CTTAAAAGATAAAAGGGGTATGG - Intronic
951766522 3:26205473-26205495 CTTAAAAGAGATGTGGAGTTGGG - Intergenic
952601045 3:35083541-35083563 CTTAAATCAGAGATGAAGTATGG - Intergenic
953831850 3:46305118-46305140 CTTAAGACATACAAGGATTAAGG - Intergenic
954694406 3:52413532-52413554 CTTAAAAAAAATATGAAATATGG + Intronic
955434394 3:58886542-58886564 TTTTAAAGATATATGGGGTATGG - Intronic
957795255 3:84996211-84996233 CTCAAAATATAAATTGAGTATGG + Intronic
958501409 3:94914419-94914441 CATAAAACATATGTGTATTATGG - Intergenic
958741475 3:98078795-98078817 CTGAAAACATCCATGGAGCAGGG - Intergenic
958981738 3:100728245-100728267 CTTTAAACATGTATAGAGTAAGG + Intronic
959137239 3:102438660-102438682 ATTTAAATATATATGGAGAACGG + Intronic
959331720 3:105014154-105014176 TTAAAAACATAAATGAAGTAAGG + Intergenic
959832220 3:110877392-110877414 CATAACACATTTAGGGAGTAGGG + Intergenic
960210960 3:114965282-114965304 CTACAAAAATATGTGGAGTAAGG - Intronic
960827423 3:121805065-121805087 CTTTTTAAATATATGGAGTATGG + Intronic
961328075 3:126122432-126122454 AATAAAACTTAAATGGAGTAAGG + Intronic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
963348069 3:144119785-144119807 CTTAAAATAAATTTGGAGTGTGG + Intergenic
965529709 3:169759321-169759343 GTTAAGAGATATATGGAGAAGGG - Intergenic
965636941 3:170791920-170791942 CTTAAAACCAATATGGGCTAGGG + Intronic
966010454 3:175068937-175068959 ATTAAAACATAAGTGGCGTATGG - Intronic
966109810 3:176386178-176386200 TTTAAAAAATATATGGAGTTAGG - Intergenic
966321215 3:178703035-178703057 CTTAAAACTTAAAGGGAATAAGG - Intronic
968120981 3:196125744-196125766 CTTAGCATATATAGGGAGTAGGG + Intergenic
968244020 3:197123929-197123951 ATTAAAACATATATTCAGTAAGG - Intronic
970371778 4:15414909-15414931 CTAAGAACAAATTTGGAGTAAGG - Intronic
971029061 4:22617452-22617474 CTTAAAACTTATTTAGAATATGG - Intergenic
971137415 4:23884746-23884768 CTTCAAACATATTTGAGGTAAGG - Exonic
971967116 4:33574163-33574185 CTTAACAAATATTTGGAGTTTGG - Intergenic
974420474 4:61665868-61665890 GATAAAACATGTATGGAGAAAGG + Intronic
974671775 4:65039538-65039560 ATTAAAACAAATAGTGAGTAAGG - Intergenic
974728034 4:65822019-65822041 CTTAAAAAATAAAAGGAGGAAGG - Intergenic
974752196 4:66155540-66155562 CTCCAAATATATATGAAGTATGG + Intergenic
974764799 4:66329912-66329934 CTTTAAACGTATAGGGAATAAGG - Intergenic
974845444 4:67346250-67346272 TTTAAAATATATATGTAGAAAGG - Intergenic
975118825 4:70706289-70706311 CTTTAAAAATATAGGGTGTATGG - Intronic
976820773 4:89204310-89204332 CTTTAAGCACATTTGGAGTAAGG + Intergenic
977277825 4:95000380-95000402 GTTAAAAAATATGTGGAGTGGGG + Intronic
977822094 4:101485056-101485078 CTCAAAATTTATATGGAATAGGG + Intronic
978833868 4:113123720-113123742 CTTTAAAAATATATGGATTATGG - Intronic
979083405 4:116373477-116373499 CTCAAAGCATATATTGAATACGG + Intergenic
979584711 4:122402889-122402911 TTAAAAACATATATAGGGTATGG - Intronic
980711693 4:136577293-136577315 CTTAAAATATGTATGGAAGATGG - Intergenic
981600547 4:146483326-146483348 TTAAAAACATAAATGGGGTAAGG + Intronic
982512340 4:156298776-156298798 TTTAAAACTTATTTAGAGTAAGG - Intergenic
983516516 4:168663023-168663045 TTTAAAATATATATGGAGAGAGG - Intronic
984094896 4:175422659-175422681 TTTAAAACAAACATGGCGTAAGG + Intergenic
984361466 4:178740263-178740285 CATATAACATATATTTAGTAAGG + Intergenic
987131124 5:14861072-14861094 CTTAAAAAATATATGTAGGCCGG - Intronic
987542637 5:19275473-19275495 TATATTACATATATGGAGTAGGG - Intergenic
987842841 5:23243137-23243159 CTTAAAATATATATTTATTATGG - Intergenic
988197120 5:28018250-28018272 CTTAAAACACATGTGTAGTTTGG - Intergenic
990089000 5:52017531-52017553 CTTAATACATATATTGAAAAGGG + Intronic
990725501 5:58749122-58749144 CATAAAATATATTAGGAGTAAGG - Intronic
990815190 5:59776885-59776907 TTTAAAAAATATATGGAGCTGGG + Intronic
991201492 5:63999308-63999330 CTTAAAGCATCTATAGAGTAGGG + Intergenic
991968480 5:72114926-72114948 TATAAAACATTTATGGAGTTGGG - Intronic
992717540 5:79525922-79525944 CTAAAAAGACATATAGAGTAAGG - Intergenic
993103805 5:83575129-83575151 CCTAAAATATTTATAGAGTATGG - Intronic
994278575 5:97870280-97870302 CTTAAAGCAGATTTGGGGTAAGG - Intergenic
996075652 5:119190053-119190075 CTTAAAAACTATATGAAATATGG - Intronic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
998833093 5:146179973-146179995 CTTAAGACATTTATGCAGTTGGG + Intronic
999788999 5:154920181-154920203 TTTAAAACAACTATGTAGTATGG - Intronic
1000452740 5:161410519-161410541 GTTAAAACATTCATAGAGTAAGG - Intronic
1003602658 6:7531971-7531993 TTTAAACCATATATGTAGTATGG - Intergenic
1007013855 6:38442978-38443000 CTTAAAACATAAAAGGATCAAGG + Intronic
1010276959 6:73979639-73979661 CTTGCAACATATGTGGAGTAAGG - Intergenic
1010826113 6:80477845-80477867 CTTAAAACATTAATGAAGTCAGG + Intergenic
1010870909 6:81037292-81037314 CTTAAAAGATATGTGCAGGAAGG + Intergenic
1011976991 6:93314463-93314485 GTTAAAACAGATATGGAGGTTGG - Intronic
1014710466 6:124800635-124800657 CTTAAAACATTTATCGGGAAAGG + Intronic
1014820188 6:125980749-125980771 CTTAAAAGATATTTGGCTTAAGG - Intergenic
1016374557 6:143407028-143407050 CTTTACACATATCTGAAGTAAGG - Intergenic
1016473251 6:144397716-144397738 CTTGAAAAATAGATGAAGTATGG - Intronic
1017034997 6:150259135-150259157 CTTAATACATATATGATATATGG - Intergenic
1017290186 6:152726935-152726957 CTTAAAATATTTATGGAGGCCGG + Intergenic
1017957133 6:159188094-159188116 CTTCAAACAAAGATGAAGTAGGG + Intronic
1018523603 6:164681037-164681059 CATAAAACATATTTAGAGTATGG + Intergenic
1018619867 6:165719702-165719724 TTTAAAACATGTTTGGAATACGG + Intronic
1020739918 7:12002212-12002234 CTTAGGACATATAATGAGTAAGG + Intergenic
1020841305 7:13221378-13221400 CTTAAAACATATCTGGGGCTGGG + Intergenic
1021496738 7:21283367-21283389 CTTAAATCATATCTAGAATAAGG + Intergenic
1026423253 7:70262546-70262568 GTTAAAACTTATATGAAGTATGG + Intronic
1026600894 7:71776416-71776438 TTTAAAACATTTTTGGAGGAGGG + Intergenic
1027591808 7:80127740-80127762 ATTAGACCACATATGGAGTAGGG - Intergenic
1027676446 7:81164128-81164150 CTTAAAACAACTCTGGAGGAAGG + Intergenic
1028150992 7:87371689-87371711 CTTAAAACATATCTGGTGAGTGG + Intronic
1028827934 7:95295145-95295167 ATTAAAAAATATATTGTGTATGG + Intronic
1029895917 7:103984090-103984112 CTTAAATAATTGATGGAGTAAGG + Intronic
1030736681 7:113056979-113057001 TTTAAAGCATATTTGGGGTATGG - Intergenic
1031492963 7:122411559-122411581 CTTAAAACAAAAAAGGAGGATGG + Intronic
1035220358 7:157402717-157402739 TTTAAAACAAATAAGGAATATGG + Intronic
1035829325 8:2677456-2677478 CTTAAAAAATATATTTAGGATGG + Intergenic
1037071603 8:14657017-14657039 CTTAAAAAAAATATGCAGTGGGG + Intronic
1037599946 8:20385541-20385563 TTTAAAACTTTTATAGAGTAAGG - Intergenic
1038810759 8:30840132-30840154 CTCCAAACATATATGAAATATGG - Intronic
1039306544 8:36269409-36269431 CTTAAAAAATATATTTACTATGG + Intergenic
1041019934 8:53628272-53628294 GTTATAACATATATGCAGAAAGG + Intergenic
1042105809 8:65325376-65325398 CTTCTAACTTATAAGGAGTATGG - Intergenic
1042421646 8:68597339-68597361 TTTAAAATATGTATGAAGTAAGG + Intronic
1042851595 8:73222203-73222225 TTTAAAAAATATATTTAGTAAGG - Intergenic
1045916967 8:107483585-107483607 TTCAAAACATATATGGCATAAGG + Intronic
1046974877 8:120263214-120263236 TGTGAAACATATATGGAGAATGG - Intronic
1048311425 8:133325227-133325249 CTTAAAACTAATATGTAGGAAGG - Intergenic
1051087532 9:13367851-13367873 CTTAATACATATATAAATTAAGG - Intergenic
1051208196 9:14712545-14712567 CTTTAAAAATATATAGACTAAGG + Intergenic
1052741261 9:32395177-32395199 CTTAAAACATAAATGCAGGCTGG + Intronic
1053544738 9:39011174-39011196 GTTAAAACTTATATGGAGGCCGG + Intergenic
1053725495 9:40995293-40995315 CTTAAAAAATATATAAAATATGG + Intergenic
1054340448 9:63856586-63856608 CTTAAAAAATATATAAAATATGG - Intergenic
1057776094 9:98010995-98011017 CTTCAAAATTATATGGAGTGGGG - Intronic
1058305247 9:103433487-103433509 GTTACAACATAATTGGAGTATGG - Intergenic
1058317863 9:103591184-103591206 CTAAAACCATATTTGGAATATGG - Intergenic
1059041590 9:110821176-110821198 TTGAAAACATATGTGGAATATGG + Intergenic
1059078879 9:111225723-111225745 CTTAATACATATATACAGGAAGG - Intergenic
1060329525 9:122654049-122654071 ATTAAAAAATACATAGAGTATGG - Intergenic
1060425605 9:123502585-123502607 TTTAAAGCATATATCTAGTAAGG - Intronic
1061348714 9:130046851-130046873 ATGAAGAGATATATGGAGTACGG - Intergenic
1061626746 9:131844948-131844970 AATAAAACAAATATGGAGTTTGG + Intergenic
1061749428 9:132766648-132766670 CTTAAAATTTATATGAACTATGG + Intronic
1203449319 Un_GL000219v1:96680-96702 CTTAAAAAATATATAAAATATGG - Intergenic
1187919354 X:24185767-24185789 CTTAAAACTTATATTGAGGTCGG + Intronic
1188552252 X:31377010-31377032 CTTAGTACATATATGCAGTTAGG + Intronic
1189742708 X:44136921-44136943 CTTAAAACATATGAAAAGTAAGG + Intergenic
1190002312 X:46700885-46700907 TTAAAAACATATCTGGAATAAGG - Intronic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1193942742 X:87696168-87696190 CTTAAGACTTATATAAAGTATGG - Intergenic
1194703589 X:97146791-97146813 ATTAAAACAGATATGTATTATGG + Intronic
1195051955 X:101105221-101105243 CTTAAAACATATATGGAGTAGGG + Intronic
1195859329 X:109364602-109364624 AATAAAACTTTTATGGAGTAAGG - Intergenic
1196762716 X:119214073-119214095 GTTAAAACATACATGGACTCTGG - Intergenic
1197471860 X:126873186-126873208 CTTAAAACTTATATGTGATATGG - Intergenic
1198801730 X:140454575-140454597 TCTGAAATATATATGGAGTATGG + Intergenic
1199101467 X:143805577-143805599 CTGTAAACCTCTATGGAGTAGGG + Intergenic
1202266565 Y:23025635-23025657 ATTTAAACATCTATGGAGGAAGG + Intergenic
1202419558 Y:24659378-24659400 ATTTAAACATCTATGGAGGAAGG + Intergenic
1202451228 Y:25010706-25010728 ATTTAAACATCTATGGAGGAAGG - Intergenic