ID: 1195052045

View in Genome Browser
Species Human (GRCh38)
Location X:101105983-101106005
Sequence CTGCATGTAAAGATCTAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195052045_1195052049 14 Left 1195052045 X:101105983-101106005 CCCTACTAGATCTTTACATGCAG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1195052049 X:101106020-101106042 TGAGATGCATATTTAGAGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 185
1195052045_1195052050 19 Left 1195052045 X:101105983-101106005 CCCTACTAGATCTTTACATGCAG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1195052050 X:101106025-101106047 TGCATATTTAGAGGCAGGTATGG 0: 1
1: 0
2: 0
3: 11
4: 157
1195052045_1195052048 10 Left 1195052045 X:101105983-101106005 CCCTACTAGATCTTTACATGCAG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1195052048 X:101106016-101106038 AAGTTGAGATGCATATTTAGAGG 0: 1
1: 0
2: 1
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195052045 Original CRISPR CTGCATGTAAAGATCTAGTA GGG (reversed) Intronic
902408392 1:16198981-16199003 CTGCTTGTAAAGATATAGGATGG - Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
909229698 1:73071091-73071113 TTTCATGTAAAGATCTATTGGGG + Intergenic
910226247 1:84939222-84939244 CTGCATGTCAAGAGCTTGTGGGG - Intronic
910308466 1:85795224-85795246 CTGAATGGAAAGATCTGGGAAGG + Intronic
915918061 1:159953045-159953067 CTTCATGTACAGATCCTGTAGGG - Intronic
916317786 1:163469701-163469723 TAGCATGTAAAGATTTAGAATGG - Intergenic
917667605 1:177240379-177240401 CAGCATGTAATGATCAAATAAGG - Intronic
918147673 1:181771913-181771935 CTGCATGGAAAGCACTAGAAGGG + Intronic
919064860 1:192681704-192681726 CTACAAGTAAAAATTTAGTATGG - Intergenic
921237136 1:213144596-213144618 CAGCATTTAAAGATCAAGTGGGG - Intronic
1063394157 10:5670904-5670926 CTGCTTGTAAAAATCAAGTAAGG - Intergenic
1066123012 10:32309736-32309758 CTGCATTTTATTATCTAGTATGG + Intronic
1071769953 10:88717237-88717259 TTGAATGAAAAGATCTAGAAGGG - Intergenic
1080282957 11:30579795-30579817 CTGAATGTAAAGGGCTAGTGGGG + Intronic
1080373514 11:31680196-31680218 CTGCATGTAATGAACTTGGAAGG - Intronic
1080997826 11:37625955-37625977 CTGGATGTAAAGAGGTAGTGTGG + Intergenic
1081002069 11:37687168-37687190 GTGCTTGTAAGGATTTAGTAAGG + Intergenic
1082256119 11:50035334-50035356 CTGCATTTCAAAATCTAGCATGG + Intergenic
1088053181 11:105543760-105543782 CTGCATGAAAAGATTTATGAAGG + Intergenic
1088187148 11:107183432-107183454 AGGCATGTAAAGAGGTAGTATGG + Intergenic
1089133759 11:116233046-116233068 CTGCAAGTCAAGATCTTGTAGGG - Intergenic
1091089118 11:132752971-132752993 TTGGATGTAAAGAGCCAGTAAGG - Intronic
1095201738 12:39392828-39392850 TTTTATGTAAACATCTAGTATGG - Intronic
1095201742 12:39392992-39393014 TTTTATGTAAACATCTAGTATGG - Intronic
1095257497 12:40056164-40056186 GTGTATGTAAGAATCTAGTATGG - Intronic
1097235505 12:57536722-57536744 CAGCATGTAGATATCTAGTAAGG - Intronic
1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG + Intronic
1099563370 12:84207682-84207704 CTGCATGGAATGATCAATTAGGG + Intergenic
1099710790 12:86222240-86222262 GTGCATTTAAAAATCTGGTATGG + Intronic
1103334302 12:120177726-120177748 CTTCATGTAAAAGTCCAGTAGGG + Exonic
1106125047 13:26894414-26894436 CTGCCTGTAAAGATCCATGATGG + Intergenic
1107847333 13:44529996-44530018 CTGAATCTAAAGATCAAGTTGGG - Intronic
1109135513 13:58645162-58645184 CTCCACATAAAAATCTAGTAAGG + Intergenic
1114863411 14:26556078-26556100 TTGCATCTATAGATCAAGTAGGG - Intronic
1118578063 14:67264587-67264609 CTGCATGTAGATATCCAGTGTGG + Intronic
1123800539 15:23815287-23815309 CTGAAGCTATAGATCTAGTATGG + Intergenic
1125587445 15:40830875-40830897 ATGCATGTAAACATTTAGCATGG + Intergenic
1127871760 15:63079932-63079954 CTGCATGAAAAGTTTTAGTATGG + Intergenic
1128062101 15:64741731-64741753 CAGGATGTAAAGATACAGTAAGG + Intronic
1128642437 15:69349510-69349532 CTGCATGTAATGTTCCAGTGTGG + Intronic
1129494682 15:75967184-75967206 CGGCCTATAAAAATCTAGTAGGG - Intronic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1135267606 16:21041003-21041025 CTGCTTGTGACGATCTAATATGG + Intronic
1140631150 16:76854106-76854128 CTTCATGGAAAGATCAAGAAGGG + Intergenic
1144199051 17:12922980-12923002 CTGTATATTAAAATCTAGTAAGG + Intronic
1148867761 17:50637840-50637862 CTGCAGGGAAAGAGCTGGTAGGG + Intronic
1156585187 18:38424102-38424124 CAGCAAGTAAAGATGTAGAAAGG - Intergenic
1162014099 19:7834691-7834713 CTGGATGAAAAGTTCTACTAGGG - Intronic
926613671 2:14973186-14973208 CTGCATGTGAAGATCAGGTATGG + Intergenic
928767281 2:34662253-34662275 CTTCATGTAAAAGTCTAGCAAGG + Intergenic
931604278 2:64036584-64036606 TCGTATGCAAAGATCTAGTAAGG - Intergenic
932913678 2:75832016-75832038 TTGCTTTTAAAGAACTAGTAAGG + Intergenic
939789738 2:146556924-146556946 CTCTATGTAAAAATCCAGTATGG - Intergenic
944613322 2:201433690-201433712 CTGCAGGTGAAGCTCTAATAGGG - Intronic
946462659 2:219882788-219882810 CTAAATGTATAGATTTAGTATGG - Intergenic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
954085075 3:48238072-48238094 CTGCATTGAAATATCTAGTTTGG + Intergenic
955814463 3:62827200-62827222 CTTCTTGGAAAGATCTAGTTAGG - Intronic
956910562 3:73812197-73812219 CTCCATGTATATAGCTAGTAGGG + Intergenic
957964348 3:87303560-87303582 ATGCATGAAAAGATTTGGTAGGG + Intergenic
959888942 3:111532608-111532630 CTATATATAAAGATGTAGTAGGG - Intronic
963826727 3:149963733-149963755 TTACATGTAAAGAACTATTAGGG - Intronic
964437340 3:156668191-156668213 TTGCATGTAAATCTCTATTATGG + Intergenic
964820933 3:160768599-160768621 CTGTTTGTAAAGAGCTAGTCTGG + Intronic
965227586 3:166009607-166009629 CTGCAAGGAAAGATCTTTTATGG - Intergenic
965702340 3:171470850-171470872 CTTCATGTAAAGGTCCAGTTAGG - Intergenic
966399090 3:179529791-179529813 CTGCCTGGAAAGATCTGGAAAGG - Intergenic
969742113 4:9036428-9036450 GGGCATGTCAAGGTCTAGTAGGG + Intergenic
972279839 4:37591107-37591129 CTGGATGTAAACAACTGGTAAGG - Exonic
973231992 4:47850610-47850632 CCGCATTTAAAGATCTAATAGGG + Intronic
977251096 4:94689943-94689965 TTGCAATTAAACATCTAGTAAGG + Intergenic
979997745 4:127452646-127452668 ATGCATGTAAAGAAGTAGAAAGG + Intergenic
980974150 4:139594928-139594950 CTGAATGTGAAGAGCTAATATGG + Intronic
981469608 4:145116083-145116105 CAGCAGGTAAAGATCTAGGCAGG + Intronic
985349644 4:189044953-189044975 TTGCATGTATAGATCTAAAAAGG - Intergenic
990087469 5:51996338-51996360 CTGCATCCAAAGATGCAGTATGG + Intergenic
995878517 5:116817894-116817916 CTGCAAGTAAATAGCTAATAAGG - Intergenic
1002625599 5:180526304-180526326 CTGAAGGTAAAGATCCAGGAGGG + Intronic
1005325849 6:24699794-24699816 CTGCATTTCATGATCTACTAAGG + Intronic
1005714656 6:28535243-28535265 GTGCATGTCTAGAGCTAGTATGG - Intergenic
1007385584 6:41518216-41518238 CTGCATGTAAACATGGAGGAAGG + Intergenic
1007976362 6:46105563-46105585 CCACATGAAAAGATCTAGAAGGG + Intergenic
1009212563 6:60880042-60880064 CTACATGTAAATATCTAGAAAGG + Intergenic
1012732150 6:102896914-102896936 CTGCATGAATTTATCTAGTAAGG + Intergenic
1013731378 6:113172097-113172119 CTGCAGGTAAAGGTCTGGCAGGG - Intergenic
1017419812 6:154262045-154262067 CTGAATGGAAAGATAAAGTAGGG + Intronic
1017612066 6:156197790-156197812 CAGCATGTAAAAATCAAGAAAGG - Intergenic
1017879942 6:158554683-158554705 CTTCATGGTAAGATCTAGCATGG - Intronic
1021837911 7:24698772-24698794 CAGCATGTAAAGAGCTGGGAGGG - Exonic
1024160639 7:46671502-46671524 TTTCCTGAAAAGATCTAGTAAGG - Intergenic
1027807629 7:82849247-82849269 ATGCTTCTAAAGAACTAGTATGG + Intronic
1030264413 7:107604057-107604079 CTGAGTGTAAAGACCTATTATGG + Intronic
1034649043 7:152675373-152675395 CTGCCATTAAAGAACTAGTAAGG - Intronic
1034718802 7:153268437-153268459 CTGAATGTAAAGCTGTAGCATGG + Intergenic
1040122336 8:43697046-43697068 ATGCTTGTAAAGATTTACTATGG + Intergenic
1041537991 8:58949563-58949585 CTGCATTTATAGAACTAGTTGGG + Intronic
1042626096 8:70758866-70758888 CTCCATGTAAAGGGCCAGTATGG - Intronic
1043992581 8:86774160-86774182 CTTCATTTGAAGATCAAGTATGG + Intergenic
1046427261 8:114071098-114071120 ATGCATTAAAAGATCTATTAAGG - Intergenic
1047512070 8:125523019-125523041 CTGTGGGTAAGGATCTAGTATGG - Intergenic
1047990130 8:130277353-130277375 CTGGATATGAAGAACTAGTATGG - Intronic
1048695447 8:137023001-137023023 CTGCAGGTGCAGATCAAGTAAGG - Intergenic
1053262633 9:36682639-36682661 ATGCATATTAAAATCTAGTATGG - Intergenic
1057823738 9:98355648-98355670 CTGAATGTATAGATCAAGTTGGG - Intronic
1059511271 9:114850393-114850415 CTACATGTACAGATGTATTATGG - Intergenic
1185831428 X:3306549-3306571 CTGCATGTATTTATCTAGCACGG + Intergenic
1186628192 X:11317738-11317760 CTTCATGTAAAGCTGTACTATGG - Intronic
1186888018 X:13934252-13934274 CTGAGTCTAAAGATCTAGTAAGG - Intronic
1189630888 X:42952153-42952175 CCACATGAAAAGATCTAGAAGGG - Intergenic
1193422648 X:81301865-81301887 CTGCATGTAAAGGTATATTTCGG + Intergenic
1193476741 X:81975399-81975421 CTGCATTATAAGATCCAGTATGG + Intergenic
1195052045 X:101105983-101106005 CTGCATGTAAAGATCTAGTAGGG - Intronic
1196050089 X:111295826-111295848 CTGCTTGTAAAGATCTGCTGAGG + Exonic
1198781479 X:140241319-140241341 ATGCATCTAAAGAACTAGAAAGG - Intergenic
1199350990 X:146799659-146799681 CTGCATGTAAATATTTAAAAAGG + Intergenic