ID: 1195056282

View in Genome Browser
Species Human (GRCh38)
Location X:101148608-101148630
Sequence ATTGATATCAATATGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195056282 Original CRISPR ATTGATATCAATATGCAGGC AGG Intronic
901134961 1:6987096-6987118 AGTGATGACAATATGCAGACAGG - Intronic
904901364 1:33859921-33859943 GTTGATAGCAATGTGCAGCCAGG - Intronic
906050415 1:42866881-42866903 ATTGATATCATTATGCTGATTGG + Intergenic
912848610 1:113101387-113101409 ATTGATTCAAATATGCAGTCAGG + Intronic
915125007 1:153657746-153657768 AATAATATAAACATGCAGGCAGG - Intergenic
923205062 1:231750984-231751006 ATTGGTCTCACTGTGCAGGCAGG - Intronic
923452664 1:234134604-234134626 GTTGATTTTAATGTGCAGGCAGG - Intronic
1063026873 10:2187972-2187994 ATAGATATGAAAATACAGGCGGG + Intergenic
1065995785 10:31057929-31057951 AATGATAAGAAAATGCAGGCCGG - Intergenic
1067284544 10:44898093-44898115 GTTGATATTAATGTGCAGCCAGG + Intergenic
1069089556 10:64182866-64182888 AAGGATATAAATATGCAAGCAGG - Intergenic
1069262831 10:66420502-66420524 ATTAAAAACAATATGGAGGCCGG + Intronic
1069803168 10:71095028-71095050 AGTAATTTCAATATGCAGCCAGG - Intergenic
1071513181 10:86279905-86279927 CTAGATATTAATATACAGGCTGG + Intronic
1072223017 10:93343520-93343542 AATGATTTTAATATGCTGGCAGG - Intronic
1073037366 10:100573504-100573526 ACTGACATGAATAGGCAGGCAGG + Intergenic
1074591639 10:114819605-114819627 ATTAATATCAATATTTAGGATGG - Intergenic
1076142330 10:128089493-128089515 ATTGATTTAAATGTGCAGGTGGG + Intergenic
1077785765 11:5382024-5382046 ATTGTTAACAATATGCAGGAAGG - Intronic
1079425617 11:20339784-20339806 TTTGCTATGATTATGCAGGCCGG - Intergenic
1079798565 11:24839865-24839887 CTTGATATTGATATGCAGTCTGG + Intronic
1080107116 11:28522311-28522333 ATTGACATAATTATGGAGGCTGG + Intergenic
1081173968 11:39903133-39903155 AGGGATTTCAATATGCAGCCTGG - Intergenic
1081183737 11:40017115-40017137 GTTGATATAAATGTGCAGTCTGG - Intergenic
1082201552 11:49377286-49377308 TTTAAGATCAAAATGCAGGCAGG + Intergenic
1087679091 11:101199184-101199206 ATAGATATCAATATGAAGTTTGG - Intergenic
1089300597 11:117496457-117496479 ATAGATAAGAAAATGCAGGCAGG - Intronic
1089659141 11:119974552-119974574 GTTGAGATCAATATACAGGCAGG + Intergenic
1093470956 12:19501733-19501755 ATTGATATCAATATGTTGTTTGG + Intronic
1094574906 12:31676273-31676295 ATTCATATCAAAATACAAGCTGG + Intronic
1094737628 12:33253074-33253096 ATTGACATCAATCTGCATGATGG + Intergenic
1095744111 12:45638639-45638661 ATTGATGTCTGAATGCAGGCAGG + Intergenic
1095988374 12:48016173-48016195 AGTGATCCCAATATGCAGTCAGG - Intergenic
1099978572 12:89571901-89571923 ATTCATTTCAAAATGCAGGCTGG - Intergenic
1108160987 13:47638968-47638990 ATTGATATCACTAGGCAGAATGG - Intergenic
1108246579 13:48521391-48521413 ATGGAAATCAATATGCGTGCAGG + Intronic
1108753789 13:53475687-53475709 AGTGATATGTATACGCAGGCAGG - Intergenic
1109469477 13:62786809-62786831 ATTGATATCAATATTGATACAGG - Intergenic
1111632830 13:90865146-90865168 ACTCATATGATTATGCAGGCTGG + Intergenic
1111810850 13:93094009-93094031 ATTGTTCTCAATATCCAGGGAGG + Intergenic
1112929559 13:104717078-104717100 ATTGATATAAATATGCAACAAGG - Intergenic
1113149726 13:107250116-107250138 GTTAATATTAATATGCAGCCAGG + Intronic
1118089597 14:62458623-62458645 ATTGATTTCAATATGCTGTTTGG - Intergenic
1120807961 14:88773577-88773599 AATGATTGTAATATGCAGGCAGG - Intronic
1124381348 15:29170009-29170031 TATAAAATCAATATGCAGGCCGG + Intronic
1125140853 15:36405709-36405731 ATTGAAATAAATCTTCAGGCTGG - Intergenic
1127370537 15:58334814-58334836 CTTGATACCAATAGGGAGGCAGG - Intronic
1128162780 15:65435342-65435364 ATTTAAAGCAATATGCAGGTCGG + Intergenic
1129854799 15:78815659-78815681 ATTTATATCAAGATACAGGGGGG - Intronic
1135096051 16:19565647-19565669 GTTGATTTAAATATGCAGGCCGG - Intronic
1137509650 16:49087705-49087727 ATTTATATCAACATGAAGCCAGG - Intergenic
1139454529 16:67062494-67062516 ATTAATATGAATAAGCTGGCCGG + Intronic
1140388389 16:74562928-74562950 ATTGATATCACAATGCAGGAGGG + Intronic
1141199431 16:81885704-81885726 AATGAAATCCAAATGCAGGCTGG - Intronic
1141551599 16:84810066-84810088 AGTGATGTCAAGATGCTGGCAGG - Intergenic
1142563100 17:822801-822823 ATTGAGAGAAATATCCAGGCTGG + Intronic
1142829492 17:2537437-2537459 GTAGATACCAATATGGAGGCTGG - Intergenic
1149497360 17:57127731-57127753 AATGATTCCAATATGCAGCCAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155336088 18:24766820-24766842 AGTGATTTCAATGTGCAGACAGG + Intergenic
1156454857 18:37287205-37287227 GGTGATACCAACATGCAGGCAGG + Intronic
1156686269 18:39650790-39650812 CTGGATTTCACTATGCAGGCTGG + Intergenic
1159779378 18:72643658-72643680 ATTGATATCAATATCCTGGCCGG + Intergenic
1159885653 18:73901913-73901935 ATTGATAACAGGGTGCAGGCAGG + Intergenic
1160683007 19:420716-420738 AGAGATATCAAAATTCAGGCGGG + Intronic
1161032915 19:2067303-2067325 TTTGATATAATTATGCTGGCTGG + Intergenic
1165151002 19:33760070-33760092 ATTGCTGTCACTATCCAGGCAGG - Intronic
1165189952 19:34054614-34054636 ATTGACATTTATATGTAGGCAGG - Intergenic
925639965 2:5978059-5978081 ATTGAGATAAATTTGCAGCCAGG + Intergenic
925686953 2:6482550-6482572 GTTGGTATCACTATTCAGGCAGG - Intergenic
928959681 2:36911193-36911215 AGTGAAATCAATATGCATGTAGG + Intronic
929324773 2:40596005-40596027 GTTAATTTCAATATGCAGTCAGG - Intronic
930314252 2:49778464-49778486 TTTGATTTCAATATATAGGCAGG - Intergenic
932298341 2:70645129-70645151 AGTGGTACCAAAATGCAGGCAGG + Intronic
934930657 2:98419988-98420010 AGTGATCCCAATATGCAGCCAGG + Intergenic
935841242 2:107113455-107113477 ATTGAAATTTATCTGCAGGCAGG + Intergenic
938337193 2:130510598-130510620 ATTAAAATAAATCTGCAGGCTGG + Intergenic
938352644 2:130610133-130610155 ATTAAAATAAATCTGCAGGCTGG - Intergenic
938646638 2:133337718-133337740 GTTGAGATCAACATGTAGGCAGG - Intronic
938873416 2:135506787-135506809 AAAGATATCAATAAGGAGGCAGG + Intronic
939562632 2:143750789-143750811 GATGATATTAATATGCAGTCTGG + Intronic
940845540 2:158637856-158637878 ACTGCTATCAATTTGTAGGCTGG - Intronic
941531985 2:166681763-166681785 ATTAATATGAATAAGAAGGCTGG + Intergenic
943257075 2:185608674-185608696 ATAGATAACAAAATGTAGGCAGG - Intergenic
943599778 2:189901631-189901653 ATTTTTATCAAAATGCAGCCGGG - Intronic
943834486 2:192501592-192501614 ATTCATATCATTTTGGAGGCAGG + Intergenic
944344316 2:198642776-198642798 TATGATATCAATATGGAGGCTGG - Intergenic
947831128 2:233142597-233142619 AATGTTATCAAAATGCTGGCTGG + Intronic
1172256002 20:33518241-33518263 ATTAAAATCAAAATGTAGGCAGG - Intronic
1172796331 20:37541582-37541604 ATTTAATTTAATATGCAGGCCGG + Intergenic
1173240997 20:41297182-41297204 ATTGAGATGCACATGCAGGCAGG + Intronic
1173351075 20:42246146-42246168 ATTGATATATATATGCAGCTGGG + Intronic
1180996351 22:19967655-19967677 AATAAAATCAATTTGCAGGCAGG - Intronic
1183553427 22:38506713-38506735 CTTGATAACAATATGGAGGACGG - Intronic
952152552 3:30607862-30607884 ATTAATATATATATGCATGCAGG + Intronic
954043109 3:47905062-47905084 ATTGGTAGCAATATGGGGGCAGG + Intronic
956144583 3:66179824-66179846 ATTGTTATTAATATACATGCTGG + Intronic
957347615 3:78982309-78982331 AAAGGTATTAATATGCAGGCGGG - Intronic
957633675 3:82752659-82752681 ATTTATATAGAAATGCAGGCTGG - Intergenic
957937170 3:86959239-86959261 TTTGATCTCAGTATGTAGGCAGG - Intronic
962523198 3:136215627-136215649 ATTAATATCAAATTGAAGGCTGG - Intergenic
966402943 3:179565144-179565166 ATTGATAACAATATGTAGAAGGG + Intronic
967112919 3:186311078-186311100 GGTGATTTCAACATGCAGGCAGG - Intronic
968693982 4:2012058-2012080 ATTTATATGGAAATGCAGGCTGG - Intronic
969729900 4:8948131-8948153 ATTGAGAACAATATCCCGGCGGG + Intergenic
969860477 4:10031913-10031935 ACAGATAACAATATGCAGGAAGG - Intronic
972181833 4:36476112-36476134 ATTGCTTTCTATCTGCAGGCTGG - Intergenic
975196838 4:71535627-71535649 AATCATATCAATATTGAGGCAGG - Intronic
976853949 4:89580875-89580897 ATTTATATCAATATGGACTCAGG + Intergenic
979999489 4:127471304-127471326 ATTATTATCAATATGTATGCAGG - Intergenic
980871395 4:138615405-138615427 ATTCATATCAAAATGAAGTCAGG - Intergenic
980956410 4:139433385-139433407 AAACATATCAATATTCAGGCTGG - Intergenic
982412561 4:155095343-155095365 ATTTATATCAACCTTCAGGCTGG - Intergenic
983031409 4:162806722-162806744 CTGGATATCCATATGCAGACAGG - Intergenic
984434093 4:179685792-179685814 AATGATATCAATAAGATGGCTGG - Intergenic
984555333 4:181207303-181207325 GTTGTTATTAATTTGCAGGCTGG + Intergenic
985137157 4:186797895-186797917 ATAGAAAGCAATATGCTGGCCGG - Intergenic
985171344 4:187153519-187153541 TTTGAGATCAAGATGCTGGCAGG + Intergenic
985504012 5:268152-268174 ATTCATATGAGTATGCACGCAGG + Intergenic
986052307 5:4101684-4101706 ACTGAAATGAAGATGCAGGCAGG + Intergenic
987699750 5:21381944-21381966 ATTGATATCAATATGGACTAAGG + Intergenic
988752653 5:34206113-34206135 ATTGATATCAATATGGACTAAGG - Intergenic
988845258 5:35120976-35120998 ATTTATATAAATAAACAGGCTGG + Intronic
990812584 5:59745850-59745872 ACTAATATAAATATGCAAGCAGG + Intronic
991395714 5:66202981-66203003 CTTGATATCAACATTCTGGCTGG - Intergenic
991740422 5:69666927-69666949 ATTGATATCAATATGGACTAAGG - Intergenic
991757077 5:69886240-69886262 ATTGATATCAATATGGACTAAGG + Intergenic
991791997 5:70246668-70246690 ATTGATATCAATATGGACTAAGG - Intergenic
991819884 5:70543032-70543054 ATTGATATCAATATGGACTAAGG - Intergenic
991836480 5:70762122-70762144 ATTGATATCAATATGGACTAAGG + Intergenic
991884445 5:71246994-71247016 ATTGATATCAATATGGACTAAGG - Intergenic
991897194 5:71415979-71416001 ATTGAGATAACTATGCAGGGTGG + Intergenic
994391714 5:99198895-99198917 ATTGTTCTCAATATCCAGGGTGG - Intergenic
994392404 5:99203283-99203305 ATTGTTAACAATATCCAGGAGGG - Intergenic
994394144 5:99214665-99214687 ATTGTTCTTAATATGCAGGTGGG - Intergenic
994395090 5:99220617-99220639 ATTGTTTTCAATATCTAGGCAGG - Intergenic
996927099 5:128840664-128840686 ATTCATGTCTATATGCATGCTGG - Intronic
997684161 5:135777095-135777117 ATTGTTTTTAATATCCAGGCGGG + Intergenic
998347401 5:141476793-141476815 CTTGATGTGAATAGGCAGGCTGG - Exonic
998576421 5:143322693-143322715 ATTCATATCAATATAAAGGAAGG + Intronic
998650460 5:144114579-144114601 ATTTATATGAAAATGCAGGGGGG + Intergenic
998935647 5:147229498-147229520 ATTGTTATTAATATCCTGGCAGG - Intergenic
1001830669 5:174786528-174786550 ATTGATGTCAATATCCTGGTTGG - Intergenic
1002506417 5:179682278-179682300 ATTAATAAGAATATCCAGGCCGG + Intronic
1004606173 6:17196848-17196870 ATTGAAAAAAAAATGCAGGCTGG - Intergenic
1007966949 6:46012134-46012156 AATGATATCAATAATTAGGCTGG - Intronic
1009368503 6:62874662-62874684 ATTGTTTCCAATATGCAAGCGGG + Intergenic
1012833064 6:104230009-104230031 ATTAATATAAAAATGCAGGCTGG + Intergenic
1012936209 6:105370218-105370240 ATTTTTATAAATATCCAGGCTGG - Intronic
1015993445 6:138972819-138972841 ATTGAAAGCACTATGCAGTCTGG + Intronic
1018548076 6:164960846-164960868 ATTGATCTAAATATGCAGTATGG + Intergenic
1018922451 6:168184749-168184771 ATTAATATTAATAGACAGGCCGG - Intergenic
1021644030 7:22770337-22770359 ATTGAAATCAATATGTTGGAGGG - Intergenic
1021915835 7:25431601-25431623 ATGGATATCACTATGCATTCTGG + Intergenic
1023723172 7:43115614-43115636 ATTGGTCTAAATAGGCAGGCAGG + Intronic
1024972310 7:55082043-55082065 AGTGATTTCACAATGCAGGCTGG + Intronic
1027157326 7:75778014-75778036 ATTGAAATAAATATGTCGGCTGG - Intronic
1030352091 7:108501004-108501026 TTTGACATCAATATGAAGGAAGG - Intronic
1030848889 7:114458377-114458399 ACTGATACCAATTTCCAGGCAGG + Intronic
1031086081 7:117303144-117303166 ATTGATTCTAATATGCAGTCAGG + Intronic
1031771164 7:125846289-125846311 GTTGATTTTAATATGCAGGCAGG + Intergenic
1033956078 7:146850364-146850386 AATGATATTAATATGCAGCTTGG + Intronic
1034513954 7:151559125-151559147 ATTCATATAAATTTCCAGGCAGG - Intronic
1035086230 7:156260773-156260795 ATTGAAATCAGTATGCAGAAGGG + Intergenic
1036092513 8:5682679-5682701 AGTGATGTGAATATGCAGGAAGG - Intergenic
1037751193 8:21683448-21683470 CTTCATATCAAGATGCAGGAGGG + Intergenic
1037854592 8:22361923-22361945 ATTGAAATCAGTATGCTGGGCGG + Intergenic
1038039857 8:23715335-23715357 ATTTATAGCAATGTGCAGGTTGG - Intergenic
1038638171 8:29303854-29303876 ATTGTTTTTAATATGCAGGGAGG - Intergenic
1040955393 8:52974749-52974771 GCTGACATCAATATGTAGGCCGG - Intergenic
1041947221 8:63459455-63459477 ATTGATATCAATGTACAGGAAGG - Intergenic
1043999032 8:86855540-86855562 ATTAATAAAAATATTCAGGCCGG + Intergenic
1045405366 8:101861095-101861117 GCTGAAATCAATATGTAGGCAGG - Intronic
1047774405 8:128057680-128057702 ATGGATGTCAAAATGCAGGGAGG - Intergenic
1049677571 8:143898706-143898728 ATTTAAAACAATATGGAGGCTGG + Intergenic
1050157838 9:2686392-2686414 ATTAATTTCAAGATGCAGGCCGG - Intergenic
1051460831 9:17312696-17312718 ATAAATATCAAAATACAGGCTGG - Intronic
1054978449 9:71175507-71175529 AGTGATGTCAATGTGAAGGCAGG + Intronic
1055722025 9:79185626-79185648 ATAGATATAGATAGGCAGGCAGG - Intergenic
1057014339 9:91637797-91637819 AGAGATATGAATTTGCAGGCTGG + Intronic
1058228430 9:102395534-102395556 ATTGATATCACTTTGAAGGAGGG - Intergenic
1058519115 9:105801932-105801954 ATTGTTCCTAATATGCAGGCGGG - Intergenic
1058824870 9:108766137-108766159 ATTGACATCAATTAGCAGGCAGG - Intergenic
1059064948 9:111073608-111073630 AGTGATTCCAATATGTAGGCAGG + Intergenic
1059221670 9:112627455-112627477 TTTAATAACAATATTCAGGCTGG + Intronic
1059474320 9:114532062-114532084 ATTCATATGAATCTGGAGGCTGG - Intergenic
1060363271 9:122981750-122981772 ATTGATTAAAGTATGCAGGCCGG + Intronic
1186017089 X:5209610-5209632 CTTCATATCAATAAGCAAGCAGG + Intergenic
1186436174 X:9544860-9544882 ATTGAAATAAATATTGAGGCTGG - Intronic
1189025033 X:37385679-37385701 ATTGCTATCAAGATGTAGGCTGG + Intronic
1191988265 X:67005210-67005232 ATTGATAACATTATGCTGACTGG - Intergenic
1193062172 X:77218666-77218688 AGTGATTTCAATGTGCAGCCAGG - Intergenic
1194343243 X:92730530-92730552 ATTGATGACATTATGCTGGCTGG + Intergenic
1195056282 X:101148608-101148630 ATTGATATCAATATGCAGGCAGG + Intronic
1200651600 Y:5847196-5847218 ATTGATGACATTATGCTGGCTGG + Intergenic