ID: 1195057932

View in Genome Browser
Species Human (GRCh38)
Location X:101164631-101164653
Sequence CTCCATAAAAACAGGTACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195057932_1195057934 -8 Left 1195057932 X:101164631-101164653 CCAAAGTACCTGTTTTTATGGAG No data
Right 1195057934 X:101164646-101164668 TTATGGAGTTTACATTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195057932 Original CRISPR CTCCATAAAAACAGGTACTT TGG (reversed) Intergenic
No off target data available for this crispr