ID: 1195066400

View in Genome Browser
Species Human (GRCh38)
Location X:101242033-101242055
Sequence CAGCAACTCAGTTGTAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195066400_1195066402 0 Left 1195066400 X:101242033-101242055 CCTGGACTACAACTGAGTTGCTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1195066402 X:101242056-101242078 TCAGTTTATGTGCTAGATTTGGG 0: 1
1: 0
2: 2
3: 12
4: 240
1195066400_1195066401 -1 Left 1195066400 X:101242033-101242055 CCTGGACTACAACTGAGTTGCTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1195066401 X:101242055-101242077 GTCAGTTTATGTGCTAGATTTGG 0: 1
1: 0
2: 0
3: 14
4: 156
1195066400_1195066404 5 Left 1195066400 X:101242033-101242055 CCTGGACTACAACTGAGTTGCTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1195066404 X:101242061-101242083 TTATGTGCTAGATTTGGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 252
1195066400_1195066405 10 Left 1195066400 X:101242033-101242055 CCTGGACTACAACTGAGTTGCTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1195066405 X:101242066-101242088 TGCTAGATTTGGGGCTGGTTTGG 0: 1
1: 1
2: 6
3: 26
4: 201
1195066400_1195066403 1 Left 1195066400 X:101242033-101242055 CCTGGACTACAACTGAGTTGCTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1195066403 X:101242057-101242079 CAGTTTATGTGCTAGATTTGGGG 0: 1
1: 0
2: 0
3: 12
4: 168
1195066400_1195066406 14 Left 1195066400 X:101242033-101242055 CCTGGACTACAACTGAGTTGCTG 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1195066406 X:101242070-101242092 AGATTTGGGGCTGGTTTGGCTGG 0: 1
1: 0
2: 1
3: 36
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195066400 Original CRISPR CAGCAACTCAGTTGTAGTCC AGG (reversed) Intronic
902386050 1:16076545-16076567 CAGCAAATCAGTGGTAGAGCGGG + Intergenic
905430082 1:37916059-37916081 CACCAATTCAGTGGTAGGCCTGG - Intronic
905856026 1:41314792-41314814 CAGCAACTCAGCTGCAGAACTGG + Intergenic
907611274 1:55873836-55873858 CAGCAATTCAGTTACAGTACAGG + Intergenic
911833765 1:102589450-102589472 CAGCAACTCAGTCACAGTTCAGG + Intergenic
912245390 1:107956808-107956830 CAGCAGCTCAGTTGTAAGCAGGG + Intronic
913968485 1:143395971-143395993 CAACACCTCAGTTTTAGTCCAGG + Intergenic
914062863 1:144221567-144221589 CAACACCTCAGTTTTAGTCCAGG + Intergenic
914116287 1:144744787-144744809 CAACACCTCAGTTTTAGTCCAGG - Intergenic
916038945 1:160945826-160945848 CAGCACCACAGTTGTAGTGGTGG - Intronic
917221191 1:172730450-172730472 CAGCAATACAGTAGTAGTCAGGG + Intergenic
919844513 1:201633026-201633048 ATGCAAGTCATTTGTAGTCCAGG - Intronic
922823101 1:228497899-228497921 CAGCAACTCAGATTCATTCCGGG + Intergenic
1067750043 10:48965527-48965549 CCTCAGCTCAGTTATAGTCCTGG - Intronic
1068765866 10:60762860-60762882 CATCCACTCAGTTTAAGTCCTGG + Intergenic
1069075801 10:64037302-64037324 CAGTAACTCAGTTGGAGTGCAGG - Intergenic
1069735233 10:70649578-70649600 CTGCAACTCAGTTGGGGTACAGG - Intergenic
1070035546 10:72719552-72719574 CAGCAAGTGAGCTGTAGTCTTGG + Intronic
1070228871 10:74542225-74542247 CTGCAACTGAGATGTAGACCAGG - Intronic
1070707953 10:78655381-78655403 CAGCAACTAACTGGTGGTCCTGG + Intergenic
1075653074 10:124142788-124142810 CAGCAAATCAGTTGCAGAGCTGG + Intergenic
1077508737 11:2944242-2944264 CAGCAACTTAGGTGTAGTGGGGG + Intergenic
1078531105 11:12137284-12137306 CATCAACTCTGATTTAGTCCTGG - Intronic
1079015911 11:16868513-16868535 AAGCAACACAGATGTGGTCCTGG - Intronic
1086491394 11:87360559-87360581 CCGCAACTCAGTTGCGGTACAGG - Intergenic
1088581577 11:111321421-111321443 CCGCCACTAAGTTGTAGCCCGGG - Intergenic
1092570635 12:9717310-9717332 CAGAAACCCCGTAGTAGTCCAGG + Intronic
1092715908 12:11390396-11390418 GAGCAACCCAGTTGCAGCCCTGG - Intronic
1095809146 12:46353561-46353583 CAGCAACACATCTGCAGTCCAGG + Intergenic
1100237602 12:92676614-92676636 CAGAAAATCATTTGTATTCCAGG - Intergenic
1100723552 12:97385011-97385033 CAGCAAGTCAGTAATACTCCTGG - Intergenic
1100742806 12:97613784-97613806 AAGCAAATCAGTTGTTGCCCTGG + Intergenic
1102884964 12:116514591-116514613 GGGCAGCTCAGTTGTAGACCAGG - Intergenic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104578472 12:129990466-129990488 GGGCACCTCAGTGGTAGTCCAGG - Intergenic
1105942166 13:25157165-25157187 CATAAACTCAGGTGTGGTCCAGG + Intergenic
1107950686 13:45458851-45458873 CAGCCACTCAGTTGTAAAACAGG - Intergenic
1117756962 14:58985071-58985093 CATCCAATCAGTTGAAGTCCTGG + Intergenic
1118769528 14:68932821-68932843 CAGCAACTAGGGTGTGGTCCAGG - Intronic
1120986595 14:90340731-90340753 CATAAACTCAGGTGTAGTCTGGG - Intergenic
1128156434 15:65394636-65394658 CAGCAAGTCAGAAGTAGGCCAGG + Intronic
1129789310 15:78330350-78330372 CAGCCACTCAGTGGCAATCCAGG + Intergenic
1130748963 15:86688884-86688906 AAGCAAGTCAGTTGTTGTCTGGG - Intronic
1139011948 16:62645368-62645390 CAGCCACTTAGTTGTAGTTGGGG + Intergenic
1139212008 16:65087400-65087422 CAGACTCTCAGTTCTAGTCCAGG - Intronic
1143396253 17:6600315-6600337 CAGCAACTCATTTTAAATCCAGG + Intronic
1149341625 17:55692589-55692611 CAGCAACTTAGTGGAAATCCAGG - Intergenic
1152850093 17:82628602-82628624 CAGCTACTCAGGTAGAGTCCAGG + Intronic
1153611165 18:6886720-6886742 CAGCGACTAAATAGTAGTCCAGG + Intronic
1153965707 18:10180040-10180062 CAGCAACACAGTAATAGTGCGGG - Intergenic
1155070675 18:22313298-22313320 CAGGAACTCAGTGTGAGTCCTGG + Intergenic
1155120941 18:22817794-22817816 CAGGATCTCACTTGTTGTCCAGG - Intronic
1158002839 18:52638739-52638761 CAGCAACACAGTAATAGTCAGGG + Intronic
1158097885 18:53795173-53795195 CAGCAACACAGTAGTAGTCGGGG + Intergenic
1160554830 18:79718244-79718266 CAGCTTCTCAGATGTTGTCCAGG + Intronic
1162191067 19:8947387-8947409 CAGCACCTCAGTTGAAATACCGG - Exonic
1162191770 19:8952655-8952677 CAGCACCTCAGTTGAAATACTGG - Exonic
1162192019 19:8954392-8954414 CAGCACCTCAGTTGAAATACTGG - Exonic
1163101788 19:15101748-15101770 CAGCACCTCTGTGGTAGTCAAGG - Intergenic
1164225780 19:23244565-23244587 CAGACACTCAGTTTTATTCCAGG + Intronic
1166899892 19:46052018-46052040 CAGCAACACAGTAATAGTGCAGG + Intronic
1202702273 1_KI270712v1_random:173439-173461 CAACACCTCAGTTTTAGTCCAGG + Intergenic
926296897 2:11575524-11575546 CAGAAAGTCAGTTGTAGGCCTGG + Intronic
930650972 2:53964791-53964813 CAGAAACTTAGGTGTAGTCAAGG - Intronic
932220189 2:69993252-69993274 CAGCAACTCAGATGTGGGCTAGG - Intergenic
934173187 2:89556886-89556908 CAACACCTCAGTTTTAGTCCAGG + Intergenic
934283503 2:91631243-91631265 CAACACCTCAGTTTTAGTCCAGG + Intergenic
935659273 2:105451709-105451731 CAGCAACTCTGGTGTACTGCTGG + Intergenic
939878721 2:147606020-147606042 AAGCTTCTCAGTTGTAGCCCTGG - Intergenic
941104592 2:161338828-161338850 CAGCAAATCAGTGGTAGTCTGGG - Intronic
943932065 2:193867734-193867756 CAGGGACTCAGCTGTGGTCCCGG + Intergenic
1172145520 20:32755134-32755156 CCTCTACTCAGTTGTAGTTCCGG + Intergenic
1174696609 20:52565764-52565786 CTGGAACTCAGTTGTAGGCAGGG - Intergenic
1177681176 21:24373510-24373532 CAGCAACACAGTTGGAGTGGGGG - Intergenic
1179275452 21:39888261-39888283 CAGCAACTCTGTGGTAGACAGGG + Intronic
1183816741 22:40308137-40308159 CAGCAACAAAGCTGTAGTCAGGG - Intronic
953845477 3:46422949-46422971 CTGCAACTCAGTTGGGGTACAGG + Intergenic
954303976 3:49715970-49715992 CAGCATCTCAGAGGTAGGCCGGG - Exonic
959162933 3:102741435-102741457 GAGCAACTCAGGTGTAATTCAGG - Intergenic
961728299 3:128947809-128947831 CAGAATCTCATTTGTTGTCCAGG - Intronic
963606410 3:147414956-147414978 CTGCAACTCAGTTTCAGCCCGGG - Exonic
969240979 4:5897305-5897327 CAACATCTCGGTTGTAGCCCAGG + Intergenic
972704102 4:41524319-41524341 CAGCAATTTAGCTGTAGCCCCGG + Intronic
976713950 4:88102986-88103008 CTGCAACTGAGTTGAACTCCTGG + Intronic
976805076 4:89037192-89037214 CAGCACCTCAGTTGCTTTCCTGG - Intronic
978906985 4:114017094-114017116 CAGCAGTTCAGTTGAAGTCTTGG - Intergenic
983885521 4:172975955-172975977 CAGCAACCCAGTTGTAGCTGTGG - Intronic
984934895 4:184881625-184881647 GAGTAACTCAGTTTTAGGCCAGG + Intergenic
990899527 5:60735470-60735492 CAGCAACACAATAGTAGTGCAGG - Intergenic
991902601 5:71475487-71475509 CTGAAACTCAGTTTTACTCCAGG + Intronic
992170619 5:74098165-74098187 CACCAACTCAGTGGTCCTCCAGG + Intergenic
993582007 5:89674607-89674629 CAGCAACTCAGTAATAGTGGGGG - Intergenic
994466346 5:100138170-100138192 CATCAAATCACTTGAAGTCCAGG - Intergenic
995526627 5:113055349-113055371 CAGCTACTGAGTTGGGGTCCTGG - Intronic
999493223 5:152071922-152071944 CATCTACTCAGTTATAGTCAGGG - Intergenic
1002027269 5:176404135-176404157 CAGCAATTCAGTTTGAATCCTGG - Intronic
1002364349 5:178698412-178698434 CAGAATCTCAGATGCAGTCCAGG + Intergenic
1002605707 5:180381599-180381621 CAGCTGCTCAGCTGTACTCCAGG - Intergenic
1002965678 6:1963976-1963998 CAGGGACTCACTTGGAGTCCTGG - Intronic
1007112677 6:39322140-39322162 CATCAATCCAGTTGTAGACCTGG + Intronic
1017805027 6:157938001-157938023 CAGCATCAGAGTTGTAGGCCTGG + Intronic
1019614819 7:1954454-1954476 CAGCTCCTCAGTTCTAGGCCTGG + Intronic
1022743420 7:33145359-33145381 CAGCAACTCAGTGGTAGGTAGGG + Intronic
1023200244 7:37688985-37689007 CTGGAAATGAGTTGTAGTCCTGG - Intronic
1026570050 7:71521425-71521447 CTGCAAATCTTTTGTAGTCCAGG - Intronic
1027838580 7:83278616-83278638 CAGCGGCACAGTTGAAGTCCTGG - Intergenic
1031498414 7:122481307-122481329 CAACAACTGACTTGTATTCCAGG - Intronic
1035495843 7:159325277-159325299 CAGCACCTGAGTTCTAGTCTGGG + Intergenic
1045543526 8:103108230-103108252 AAGCAGCTCAGTTGTTGGCCAGG + Intergenic
1046137980 8:110055490-110055512 CAACAACTAAGTTGTCATCCAGG + Intergenic
1047476591 8:125238049-125238071 CAACACCTCATTTCTAGTCCTGG + Intronic
1048965920 8:139614413-139614435 CAGCAGCTCATTTGCAGCCCAGG - Intronic
1050665138 9:7927336-7927358 CAGCAACACAGATGAGGTCCAGG + Intergenic
1051516464 9:17935506-17935528 CAGGAACTCAGTTTTAGCCATGG - Intergenic
1052324937 9:27207339-27207361 AAGAAACTCAGATGTAGTCAAGG - Intronic
1056467168 9:86869006-86869028 AAACAATTCAGCTGTAGTCCTGG - Intergenic
1056834223 9:89941716-89941738 CAGCAATTCAGCTGTAGTATAGG + Intergenic
1057761017 9:97874437-97874459 CAGCAAGTCAGGAGTAGCCCAGG + Intergenic
1058241600 9:102569158-102569180 CAGCAAGTTAGTTCTAGTGCAGG + Intergenic
1059291000 9:113223490-113223512 CAGTTACTCAGTAGAAGTCCAGG - Intronic
1060778744 9:126396058-126396080 CAGCAACTCATTTGAAACCCAGG + Intronic
1060881548 9:127121687-127121709 CATCCACTCAGTTGGAGACCCGG + Intronic
1061152638 9:128837613-128837635 CAGCAACTCAGTAACAGTGCAGG + Intronic
1061750497 9:132773697-132773719 CAGCAACTGGGTTGGAATCCTGG - Intronic
1187106622 X:16249932-16249954 CAGTTACTCAGTTGTGGTGCAGG + Intergenic
1187384760 X:18838111-18838133 CAGCAGTTCAGGTGTAGTTCAGG - Intergenic
1188956176 X:36436989-36437011 CAGCAGCACAGTTGCAGTGCTGG + Intergenic
1189058961 X:37731406-37731428 GAGCAATTAAGTTGTAGTGCTGG - Exonic
1195066400 X:101242033-101242055 CAGCAACTCAGTTGTAGTCCAGG - Intronic
1197055290 X:122111628-122111650 CAGCAACACAGTAGTAGTGGGGG - Intergenic
1198097387 X:133393334-133393356 AAGCAACTAATTTGTAGTTCAGG + Intronic
1198338809 X:135693660-135693682 GAGTATCTCAGTTGGAGTCCTGG - Intergenic
1198373104 X:136011081-136011103 AAGGACCTGAGTTGTAGTCCTGG + Intronic
1202288668 Y:23283645-23283667 CAGCAACTCTGTTGTATTAGAGG - Intronic