ID: 1195066872

View in Genome Browser
Species Human (GRCh38)
Location X:101245171-101245193
Sequence TGGGATTCCTCCATCCAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 114}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195066862_1195066872 25 Left 1195066862 X:101245123-101245145 CCCTCCCTCTCCTGCCTTTTTGC 0: 1
1: 0
2: 8
3: 111
4: 1048
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114
1195066859_1195066872 30 Left 1195066859 X:101245118-101245140 CCACCCCCTCCCTCTCCTGCCTT 0: 1
1: 6
2: 43
3: 520
4: 4532
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114
1195066864_1195066872 21 Left 1195066864 X:101245127-101245149 CCCTCTCCTGCCTTTTTGCTACC 0: 1
1: 0
2: 5
3: 51
4: 482
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114
1195066860_1195066872 27 Left 1195066860 X:101245121-101245143 CCCCCTCCCTCTCCTGCCTTTTT 0: 1
1: 0
2: 16
3: 244
4: 2121
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114
1195066866_1195066872 15 Left 1195066866 X:101245133-101245155 CCTGCCTTTTTGCTACCTGTCCT 0: 1
1: 0
2: 1
3: 26
4: 296
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114
1195066861_1195066872 26 Left 1195066861 X:101245122-101245144 CCCCTCCCTCTCCTGCCTTTTTG 0: 1
1: 1
2: 7
3: 104
4: 1058
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114
1195066868_1195066872 0 Left 1195066868 X:101245148-101245170 CCTGTCCTTGTCACTCTGTCTGT 0: 1
1: 0
2: 1
3: 25
4: 469
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114
1195066871_1195066872 -5 Left 1195066871 X:101245153-101245175 CCTTGTCACTCTGTCTGTTGGGA 0: 1
1: 0
2: 3
3: 19
4: 201
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114
1195066867_1195066872 11 Left 1195066867 X:101245137-101245159 CCTTTTTGCTACCTGTCCTTGTC 0: 1
1: 0
2: 0
3: 24
4: 239
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114
1195066863_1195066872 24 Left 1195066863 X:101245124-101245146 CCTCCCTCTCCTGCCTTTTTGCT 0: 1
1: 0
2: 4
3: 98
4: 962
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114
1195066865_1195066872 20 Left 1195066865 X:101245128-101245150 CCTCTCCTGCCTTTTTGCTACCT 0: 1
1: 0
2: 4
3: 31
4: 482
Right 1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG 0: 1
1: 0
2: 3
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195066872 Original CRISPR TGGGATTCCTCCATCCAGTT CGG Intronic
902193770 1:14782791-14782813 TGGGATTCCTCCAGCGACTCAGG - Intronic
902284983 1:15401969-15401991 TGCAATGCCTCCGTCCAGTTGGG + Intergenic
903628951 1:24751652-24751674 TGGGGTTTCTCCATCCAGCTTGG + Intronic
904066434 1:27755493-27755515 TGGCATTACTCCAGTCAGTTGGG + Intronic
904906915 1:33904349-33904371 TGGGTTGTTTCCATCCAGTTTGG - Intronic
906101441 1:43266300-43266322 TGGGATTCTTCCTTGCAGTGAGG + Intronic
906675717 1:47692336-47692358 TGGTATTCCTAGAACCAGTTGGG - Intergenic
907615467 1:55920230-55920252 TAGGATTCCTGCATCCTTTTTGG + Intergenic
912172679 1:107119689-107119711 TGGGATTGCTCCCTACAGTGTGG - Intergenic
917303677 1:173605383-173605405 TGGGCTTTCTCCATGCAGCTGGG - Intergenic
921031056 1:211335609-211335631 TGTGCCTCCTCCATCAAGTTAGG - Intronic
922911234 1:229219360-229219382 TAGAATTACTCCATCAAGTTTGG + Intergenic
1063425702 10:5948488-5948510 TGGGGCTCCTCCATCCTGTTGGG - Intronic
1064807113 10:19147880-19147902 GGGGATTCTTCCCTCCAATTAGG - Intronic
1065006598 10:21386199-21386221 TGGAATTCCAGCAACCAGTTTGG - Intergenic
1065821603 10:29530553-29530575 TGGGATTACTGCACCCAGTAGGG + Intronic
1065864141 10:29898885-29898907 TGAGAGTCCTGCAGCCAGTTTGG + Intergenic
1070741560 10:78906692-78906714 TCAGATTTCTCCATCAAGTTTGG - Intergenic
1072352803 10:94574698-94574720 TTGAATTCAGCCATCCAGTTAGG - Exonic
1074720794 10:116263475-116263497 TGGGATTCATTCACCCAGGTTGG + Intronic
1074957903 10:118410553-118410575 TGGAATTCTTCTCTCCAGTTGGG + Intergenic
1076354748 10:129843424-129843446 TGTGGCTCCTCCATCCGGTTGGG + Intronic
1076616839 10:131760647-131760669 TGGGGTTCCTCCACCCTGTATGG - Intergenic
1076761456 10:132608021-132608043 TGGCATTCCTCCATGGAGTCTGG + Intronic
1076830263 10:132990966-132990988 TGGGTCTCCTCCATCCACTGAGG - Intergenic
1080973472 11:37305603-37305625 TTGGATTCCTTAATCCAGTACGG - Intergenic
1081615990 11:44591518-44591540 TGGGTTTCCTTTGTCCAGTTAGG - Intronic
1081693542 11:45094395-45094417 TGGGGTCCCTCCATGCAGCTGGG - Intergenic
1081767894 11:45624539-45624561 TGGGATCCCTCTATCCACTGGGG - Intergenic
1085775458 11:79362050-79362072 TGAGATTCTTGCATCCAGTTAGG + Intronic
1086113972 11:83227879-83227901 TATGATTCCTCCTTTCAGTTCGG + Intronic
1090977647 11:131690768-131690790 GAGGATTCCTCCTTACAGTTTGG + Intronic
1093432492 12:19099613-19099635 AAGTATTCCTCCAACCAGTTAGG + Intergenic
1096621554 12:52868824-52868846 TTGGATTCCTCCATCCCCTCTGG - Intergenic
1100493043 12:95099431-95099453 CCAGATTCCTCCAACCAGTTAGG - Intronic
1100604982 12:96144204-96144226 TGGAATTCCTCCTTCCAGGATGG - Intergenic
1102851305 12:116247645-116247667 TGGTATTCCTCCATACAATGAGG + Intronic
1107721709 13:43255465-43255487 TTGGCTTCTTCCATCCAATTTGG - Intronic
1111007149 13:82262855-82262877 TGGGCTGCCACCATCCAATTTGG - Intergenic
1114042020 14:18687835-18687857 TGGGATCCTTCCATCCAGAACGG - Intergenic
1114190771 14:20438016-20438038 TGGGATGGCTCCATACAGCTTGG + Intergenic
1114934838 14:27521353-27521375 TGGGATTTCTCCATTGGGTTTGG + Intergenic
1116584256 14:46682516-46682538 TTGAATTCTTCCTTCCAGTTTGG + Intergenic
1124345366 15:28918487-28918509 CGGGATTCCTCCTTGCAGTGGGG - Intronic
1131447060 15:92508552-92508574 TGGGATTACTTCATCAAATTAGG + Intergenic
1133512135 16:6470159-6470181 TGAAATTCCTGCATCCAGGTAGG + Intronic
1135978474 16:27127384-27127406 TGTGTTTCCTGCATGCAGTTGGG - Intergenic
1142291923 16:89197166-89197188 TGTGATTCCTCCATCCAGTAAGG - Intronic
1143248338 17:5503965-5503987 TAGGTTTCCTTCATCCATTTAGG + Intronic
1144401603 17:14908544-14908566 TGGGATTCATACATCCTGCTGGG + Intergenic
1146668001 17:34717444-34717466 TTTGTTTCCTCCATCCAGTGGGG - Intergenic
1148586989 17:48787985-48788007 TTGGCTTCCTCAATCCTGTTGGG + Exonic
1151266941 17:72963679-72963701 TGGGATTCCTCCTATGAGTTTGG - Intronic
1153136719 18:1925926-1925948 GGGGATTCCTCAAAACAGTTTGG + Intergenic
1156523667 18:37745416-37745438 TGTGCTTTCTCCATCAAGTTTGG + Intergenic
1156818703 18:41343658-41343680 TGGGATTCCTCCAGCAAATTGGG - Intergenic
1157312556 18:46562941-46562963 TGGGCTGCCTCCCTCCAGTTGGG - Intronic
1160039238 18:75330827-75330849 TGGGATTCCACTTTCCAGTTAGG + Intergenic
1160839775 19:1140933-1140955 AGGGATTCCTCCATCCAGTCAGG + Intronic
1161988592 19:7670920-7670942 GGGGATTCCTCCTTGCAGGTAGG - Intergenic
1163187558 19:15649693-15649715 TGAGATGCCTCCATGCAGCTAGG - Intronic
1168515170 19:57004689-57004711 TTGGATTCCTGCAGCCAGTGGGG - Intergenic
925095006 2:1191238-1191260 AGGCATTCCTCTATCCAGCTGGG + Intronic
926830893 2:16960520-16960542 TGGGATTCCTCCCTCAGGATTGG + Intergenic
928845906 2:35671603-35671625 TATGATTCTTCCTTCCAGTTTGG + Intergenic
929054693 2:37865848-37865870 TGGGTTCCCTCCCTCCAGCTGGG - Intergenic
929224078 2:39495021-39495043 TGGGCTTCCCCCACCCAGCTTGG + Intergenic
935816639 2:106852333-106852355 TGGGATTGCTCCATGCATTCTGG - Intronic
936062808 2:109306702-109306724 TGTGATTCTGCCATCCAGGTTGG - Intronic
938268197 2:129944697-129944719 TGGGATCCTTCCATCCAGAACGG + Intergenic
940346255 2:152631878-152631900 TGGGAATGCTCCAGCCTGTTGGG + Intronic
945101447 2:206266000-206266022 TAGGTTTTCTCCATTCAGTTGGG - Intergenic
945124113 2:206489233-206489255 TGTGATTCCTGAATCCAGATTGG + Intronic
946006949 2:216533492-216533514 TGGCATTCCTTCATCCAGCAAGG - Intronic
946429751 2:219618983-219619005 ATGGATTCCTCCATTCAGTCTGG + Intergenic
947432502 2:230043476-230043498 TGGGATTCCTTCACCCACTGGGG + Intronic
947441515 2:230126007-230126029 AAGGATTCATCCATCCAGCTAGG - Intergenic
1169474617 20:5919776-5919798 AGGCATTCATCCAACCAGTTGGG - Intronic
1170796752 20:19554073-19554095 TGGGTATCCTCTATCCAGTATGG + Intronic
1170932942 20:20785367-20785389 TGCTATTCCTCCAACCAGTCAGG + Intergenic
1172014765 20:31866747-31866769 TTGGATTCATCCATCCAGTTGGG + Intronic
1172341012 20:34157551-34157573 TGGACTTCCTCCATCAAGTGAGG + Intergenic
1172343425 20:34177887-34177909 TGGGTTTCTGCCATCCAGTCAGG + Intergenic
1174480280 20:50826353-50826375 TGGGACTGCTCCCTCCAGATGGG - Intronic
1176019351 20:62954585-62954607 TGGGAATCCTCCATCCTGCTGGG - Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1177076341 21:16579218-16579240 TGGAATACCTCCATCCAGCTAGG - Intergenic
1182269914 22:29146893-29146915 TGGGATTCCTGCCTCCCCTTGGG + Intronic
1183197558 22:36363857-36363879 TGGGAAGCCTCCAGCCAGCTGGG - Intronic
1184774921 22:46618368-46618390 TGTCATTCCACCATCCTGTTTGG - Intronic
949649206 3:6135619-6135641 TGGGATTCCTGAATACAGGTTGG + Intergenic
951709949 3:25577170-25577192 TGGGATTCACCCACACAGTTGGG - Intronic
951768963 3:26233371-26233393 TGGAATTACTCCATCCATATTGG + Intergenic
953957601 3:47243797-47243819 TGGGCATCCTCCTGCCAGTTCGG - Intronic
961852583 3:129836674-129836696 TGGGATTCTTCCATGCTCTTGGG - Intronic
967934233 3:194713884-194713906 TGGGATTCCTCCATGCTAATGGG - Intergenic
969799211 4:9549474-9549496 TGGGATTCCTCCTGCATGTTTGG - Intergenic
971046049 4:22806351-22806373 TGTGATTCCACCACCCAGATGGG + Intergenic
974798878 4:66789125-66789147 TGTTATTTCTCTATCCAGTTAGG + Intergenic
984123887 4:175781256-175781278 TGGGATTCCTCAGTCCGCTTGGG - Intronic
985988027 5:3533634-3533656 TTGGTTTCCTCCATCCAGATGGG + Intergenic
990536895 5:56732107-56732129 GGTGATTCTTCCATCCAGCTAGG + Intergenic
994649538 5:102509280-102509302 TGGGTTTCCTCCATCCAAGCAGG - Intergenic
999244052 5:150144075-150144097 CGCTATTCTTCCATCCAGTTTGG - Intronic
1002337327 5:178489054-178489076 AGGGACCCCTCCATCCAGTCAGG - Intronic
1002776064 6:328347-328369 TGGATTTCCTCCAGCCAGTACGG - Intronic
1006990346 6:38209790-38209812 TGGGATTCCTTGATCTAGGTAGG + Intronic
1012579051 6:100841962-100841984 TGGAATTTCTCCATCCAGTGTGG - Intronic
1013192476 6:107815303-107815325 TGGGACTGCTCCATCCACTGAGG - Intronic
1013838365 6:114359839-114359861 TGGGCTTCTTCTATCCACTTGGG + Intergenic
1015935901 6:138405214-138405236 TGGGATTCAGCCATCCAGACGGG + Exonic
1016625840 6:146167187-146167209 TGAGATTCCTTCATGCTGTTGGG + Intronic
1022524743 7:31029661-31029683 AGGCATTCCCCCATCCAGGTTGG + Intergenic
1028821091 7:95212843-95212865 TGGGATTTCTTTAACCAGTTGGG + Intronic
1029327775 7:99824392-99824414 TGGGCTTCTTCCACCCACTTGGG - Intergenic
1030297249 7:107941420-107941442 TTGGAGTCCACAATCCAGTTAGG - Intronic
1034882608 7:154774038-154774060 TGGGCTTCATCCATCCACTTGGG - Intronic
1041224054 8:55680880-55680902 TGAGATTCATCCATGCTGTTAGG - Intergenic
1041258513 8:56000178-56000200 TGGGTTTCCTCCTTCCAGTCAGG - Intronic
1045550931 8:103171796-103171818 TGGGTTTCCTGGATCCAGCTAGG - Intronic
1047217225 8:122886112-122886134 TGTGATACATCCATCCAGTGGGG + Intronic
1047531591 8:125681817-125681839 TGGGTGTCCTCCAACCAGCTAGG - Intergenic
1060394712 9:123307497-123307519 AGAGAATCCTCCATGCAGTTAGG + Intergenic
1187228718 X:17399829-17399851 TGCCATTCCTACATCCATTTGGG - Intronic
1190712993 X:53082787-53082809 TGGGATTCTACCATCGAGTCGGG + Exonic
1193587680 X:83345930-83345952 AGGGTTTCCTCCTTCCAGCTGGG + Intergenic
1195066872 X:101245171-101245193 TGGGATTCCTCCATCCAGTTCGG + Intronic
1196311426 X:114171225-114171247 TGGGATTCCTACATGAAGATGGG - Intergenic
1199425054 X:147691693-147691715 TCTGATTCATACATCCAGTTTGG - Intergenic
1200934131 Y:8723483-8723505 TGGTATTCCTCCATCGCCTTGGG - Intergenic