ID: 1195067581

View in Genome Browser
Species Human (GRCh38)
Location X:101251545-101251567
Sequence TAACATCTATTGTATCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 8, 3: 35, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195067581_1195067583 16 Left 1195067581 X:101251545-101251567 CCATGCAGATACAATAGATGTTA 0: 1
1: 0
2: 8
3: 35
4: 199
Right 1195067583 X:101251584-101251606 TAGAGAGTAGCAAAGTAATTAGG 0: 1
1: 0
2: 3
3: 19
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195067581 Original CRISPR TAACATCTATTGTATCTGCA TGG (reversed) Intronic
902101241 1:13991479-13991501 TTACATTTATTTTATCTGTATGG - Intergenic
903610312 1:24606644-24606666 GAACATGTCTTGAATCTGCAAGG - Exonic
904707608 1:32403206-32403228 TTACATTTATTGTATCTATATGG + Intergenic
906000689 1:42421887-42421909 TGACATCTATTGTATTGGTATGG + Exonic
906673145 1:47674669-47674691 TAACAGCTGTTGTATCTGTGTGG - Intergenic
906914107 1:49989830-49989852 TAAGATCTGTGGTATCTGTAAGG - Intronic
908699937 1:66888001-66888023 AAATATCTATTGTATCTGTATGG + Intronic
909661942 1:78093675-78093697 TAACATCTTCTGAATCAGCAGGG - Intronic
910133068 1:83932511-83932533 TAACATGTATTGTGTCTCCAAGG - Intronic
912336055 1:108863947-108863969 CAGCATTTATTGTATCTCCAGGG + Intronic
913938021 1:125073908-125073930 AATCATCTATTGTATCCGAATGG + Intergenic
918594103 1:186273163-186273185 TTAGATCAAATGTATCTGCACGG + Intergenic
920935420 1:210429179-210429201 TAACAACTGTTGGATCTACATGG - Intronic
921639484 1:217535093-217535115 TAACATCTATGAAATCTGCTAGG - Intronic
921777516 1:219118799-219118821 TAACTTCTATTTTAAGTGCAAGG - Intergenic
923894076 1:238249730-238249752 TAATATCTATTATATATTCATGG + Intergenic
1063433717 10:6013689-6013711 TTACATCTATTGTGTCCGCATGG - Intronic
1063828342 10:9924091-9924113 TTACTTCTATTGTAACTGTATGG - Intergenic
1064968845 10:21042549-21042571 TCACATCTCTTGTATCTGTAAGG + Intronic
1065057013 10:21856420-21856442 TTATATCTATTGTAGCTGCATGG + Intronic
1066587750 10:36956169-36956191 TAACATCTAAGTTATCTTCAAGG + Intergenic
1067706320 10:48608931-48608953 TGACATCTATTGTTTCTACATGG + Intronic
1067931349 10:50565397-50565419 TGACTTCTACTGTATCTGCTTGG + Intronic
1068079706 10:52305351-52305373 TTATATCAATTGTATCTGTATGG + Intergenic
1068804893 10:61184499-61184521 TTATATCTATTATATCTGTATGG + Intergenic
1068968867 10:62941798-62941820 TAACATTTATAGTATCTAAAAGG - Intergenic
1069445328 10:68468089-68468111 TAACAGTTAATGTTTCTGCAGGG - Intronic
1070586151 10:77768122-77768144 CAACATCTATTGTATCTTGGTGG - Intergenic
1071301939 10:84262362-84262384 TAAAATTCATTGTGTCTGCAGGG - Intergenic
1072366643 10:94717750-94717772 TAAAATCAATTGTAGTTGCATGG + Intronic
1072922920 10:99591809-99591831 TGACATTTATTGGCTCTGCATGG + Intergenic
1075901944 10:126050192-126050214 TACCTTCTATTTTATTTGCAAGG + Intronic
1078632097 11:13011748-13011770 TAACATCTATTGTGTTTACTAGG - Intergenic
1079647184 11:22880144-22880166 TAACAGATATTTTATCTGGATGG - Intergenic
1081218691 11:40434246-40434268 TAACATATATTGTGTCTGCCTGG - Intronic
1081294245 11:41365774-41365796 TAATATATAATGTACCTGCATGG + Intronic
1086221008 11:84443239-84443261 TAACATTTATTAAATCTGGATGG - Intronic
1087905440 11:103690955-103690977 TAACATACATTTTATCTGTAAGG - Intergenic
1088455462 11:110028576-110028598 TAACATTTATGGTATGTGCCTGG + Intergenic
1089228150 11:116944586-116944608 TAACATATCTTGTATCCACATGG + Intronic
1090045188 11:123325518-123325540 TTTCATCTAGTGTATTTGCAGGG - Intergenic
1090851481 11:130574521-130574543 TTACGTCTAGTGTATCTGCCTGG - Intergenic
1094003321 12:25719718-25719740 TAACAAAGATTGCATCTGCAAGG + Intergenic
1095319473 12:40808475-40808497 TTACACCTATTTTATCTGTATGG - Intronic
1098644985 12:72887975-72887997 TCACAACTATTATAACTGCATGG - Intergenic
1099622985 12:85027423-85027445 CAACTTCTATTGTATATTCAGGG - Intronic
1099648314 12:85390095-85390117 TAACATATGTTGCATCTGTATGG + Intergenic
1100062491 12:90598389-90598411 TATTATGTATTGTATCTGGATGG - Intergenic
1102186769 12:110954685-110954707 TAAAGTCTATTGTATCTATATGG + Intergenic
1103068804 12:117923340-117923362 TAACGAATATTGAATCTGCAGGG - Intronic
1103873510 12:124108808-124108830 TTACATCTATGGTATCTGACTGG - Intronic
1104245763 12:127039896-127039918 TAACCTTTTTAGTATCTGCAAGG - Intergenic
1106378559 13:29213789-29213811 TAACATCAAATGTATATGAAAGG - Intronic
1107373564 13:39777978-39778000 TAACATTCATGGTATCAGCAAGG + Intronic
1111021341 13:82456466-82456488 TAACATGGATTTCATCTGCATGG + Intergenic
1111495332 13:89041307-89041329 TGAAATATATTGTATCTGTATGG - Intergenic
1112288172 13:98122501-98122523 TAACATCTATGGCATGTGGAAGG - Intergenic
1117875029 14:60243433-60243455 TTACATGCATTGTGTCTGCATGG - Intergenic
1121103572 14:91265778-91265800 TTACACCTATTGTATCTGTATGG + Intergenic
1121655162 14:95589592-95589614 TTACATCGATTGTATCTATATGG + Intergenic
1124049891 15:26187149-26187171 TTACATATATTTTATCTTCAGGG + Intergenic
1125551512 15:40548512-40548534 TGACATTTATTGAATCTGTAGGG + Intronic
1126765976 15:52011465-52011487 TAACATGTATTTTCTCTGTAGGG - Intronic
1127113015 15:55695031-55695053 TTACATTTATTGTGTTTGCAAGG - Intronic
1128617871 15:69124292-69124314 TAACATCTAAACTCTCTGCATGG - Intergenic
1128647042 15:69385230-69385252 CTACATCTACTGTATCTGCATGG - Intronic
1128773209 15:70298947-70298969 TTACATCTATTGTATATGTATGG + Intergenic
1130078063 15:80707305-80707327 TAAAGTCTGTTGGATCTGCAGGG + Intronic
1133590536 16:7238643-7238665 TAACTTTTATTTTATCTTCAGGG + Intronic
1135846415 16:25922662-25922684 TAACAGCTGTTATCTCTGCAAGG - Intronic
1137094751 16:36240105-36240127 AAACATCTATTGTACCCGAATGG - Intergenic
1137328716 16:47468857-47468879 TAATAGCTATTTTATCTGCCTGG + Intronic
1137411729 16:48234237-48234259 TTACATCTATTATATCTCTATGG - Intronic
1138106073 16:54287630-54287652 TAACCTCTTTTCTCTCTGCAAGG + Intergenic
1138233507 16:55359029-55359051 TTACAGCTATTGCATCTGTAAGG - Intergenic
1140016921 16:71196543-71196565 TAACAAATATACTATCTGCAAGG - Intronic
1142994470 17:3752449-3752471 TAACATCTCTTACAGCTGCATGG - Intronic
1143336261 17:6173819-6173841 TAACTTGTATTATATCTTCAAGG + Intergenic
1144375126 17:14632161-14632183 TGGTTTCTATTGTATCTGCAAGG - Intergenic
1144845513 17:18216471-18216493 TTACATCTATTGTATCTGTATGG - Intergenic
1146749198 17:35362246-35362268 TTACATCTATTGTATCTGTGTGG - Intronic
1148994430 17:51697212-51697234 TAACATGTATTTTAGCTTCATGG + Intronic
1150812249 17:68365821-68365843 TTACATCTATTGTATCTGTGTGG - Intronic
1153035988 18:762933-762955 TAACATTTGTTGTATTTCCATGG - Intronic
1153292119 18:3511777-3511799 GAACATATATTTTATCTGTAGGG - Intronic
1153326141 18:3822370-3822392 AAACATTTACAGTATCTGCAGGG + Intronic
1155557994 18:27042968-27042990 AAACATCTATTGGAGTTGCAGGG - Intronic
1158559467 18:58501757-58501779 TAATATCTATCTTCTCTGCAGGG + Intronic
1159439792 18:68463481-68463503 TAACTTCTATTAGATGTGCAAGG + Intergenic
1159971408 18:74658959-74658981 TAAAATCTATTGTATACACATGG + Intronic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
925830411 2:7888705-7888727 TAACAACTACCATATCTGCATGG + Intergenic
927612688 2:24557619-24557641 TAATATATTTTGTGTCTGCAGGG + Intronic
929010042 2:37432650-37432672 TAATTTCCATTGTATTTGCATGG + Intergenic
931133316 2:59365261-59365283 TAACATCTATTTTAGGTTCAGGG + Intergenic
931392496 2:61856053-61856075 TTGCATCTACTGTATCTGTATGG - Intergenic
932762401 2:74447278-74447300 TTACATCTTTAGTATCTGTATGG + Intergenic
935757632 2:106288882-106288904 TAAAACCTATGCTATCTGCAGGG - Intergenic
936586173 2:113759971-113759993 TAACACCTTATGTATCTTCAGGG - Intergenic
938536233 2:132252179-132252201 TAACATCAATTGTAACTGGTAGG - Intronic
939293820 2:140230681-140230703 TATCATCTAAAGTAGCTGCAGGG + Intergenic
939418872 2:141939669-141939691 TTACTTCTCTTGTATTTGCATGG + Intronic
939595480 2:144117744-144117766 TAACATTTTATGTATATGCATGG - Intronic
940311515 2:152284221-152284243 TTACATCTATTGTGTCTGTTTGG - Intergenic
943496279 2:188625117-188625139 TAAGATTTATTGTGTCTCCAAGG - Intergenic
943527841 2:189039841-189039863 TAAAATATGTTGTATCTTCAAGG - Intronic
945255313 2:207798306-207798328 TTACGTCTGTTGTATCTGTATGG + Intergenic
945769525 2:214023781-214023803 TACCATTTATAGTAACTGCAAGG - Intronic
945897428 2:215499720-215499742 TAACATCTATGGTCTATGCTGGG + Intergenic
947002816 2:225476770-225476792 TTAGGTCTATTGTATCTGTATGG - Intronic
947589580 2:231377897-231377919 TCACATCTGTTGCATCTGTATGG + Intergenic
1169970055 20:11260330-11260352 TTACATCAATTGTATCTGCATGG + Intergenic
1171176883 20:23058141-23058163 TATCATCTATTGGATTTCCATGG + Intergenic
1173057602 20:39631027-39631049 AGACATCTTTTGTATCTGGATGG - Intergenic
1173603800 20:44314930-44314952 TTACATCTATTGTTCCTGTATGG + Intergenic
1174512043 20:51060768-51060790 TAACATCCACTTTATCTGCAAGG - Intergenic
1174737652 20:52980995-52981017 TCAAATCTATTCTATGTGCACGG + Intronic
1177693948 21:24547420-24547442 TCTCTTCTATTGTATCTGGAAGG - Intergenic
1178206787 21:30477157-30477179 TAACAGATATTCTATCTTCAAGG + Intergenic
1178899191 21:36585462-36585484 TTGCACCTATTGTATCTGGAGGG - Intergenic
1179017017 21:37602765-37602787 TGACATCTATTGTATATGCCTGG - Intergenic
1180630327 22:17225086-17225108 TAACATCTTTTATATCTCTAAGG - Intergenic
1182936239 22:34224496-34224518 TAACATTTATTGAATGTGCCAGG + Intergenic
1183430074 22:37760458-37760480 TCACATCTACTGTATCCGCATGG - Intronic
949183326 3:1161004-1161026 TCATATCTATTGTATTTGTATGG + Intronic
950113626 3:10436320-10436342 GACAGTCTATTGTATCTGCATGG + Intronic
952144908 3:30521648-30521670 GAACATCACTGGTATCTGCATGG + Intergenic
952557563 3:34550479-34550501 TAACATCTATTATAGCAACAAGG - Intergenic
953514460 3:43576589-43576611 CAACATCTATTTTCTCTGCAAGG + Intronic
955414827 3:58682474-58682496 TTACATATAGTGTATCTGCATGG - Intergenic
955616971 3:60819969-60819991 TAAAATATATTGTTTCTGGAAGG - Intronic
955790258 3:62581876-62581898 TTTCATCTTTTATATCTGCATGG - Intronic
956536618 3:70283826-70283848 TAACATCTGTTAAATCTGGATGG + Intergenic
958119993 3:89273827-89273849 TAACATGTATTTTCTCTGTAAGG + Intronic
958450874 3:94271003-94271025 AACCCTCTATTCTATCTGCATGG + Intergenic
960367651 3:116792909-116792931 TAACATCTATTAATTCTGCATGG + Intronic
962085826 3:132190541-132190563 TAAATTCTATGGTATGTGCAGGG + Intronic
962440623 3:135412332-135412354 CTGCATCTATTTTATCTGCATGG - Intergenic
965601424 3:170458215-170458237 TTACAATTATTATATCTGCATGG - Intronic
965877544 3:173345472-173345494 TAACATCTATTTTAGGTTCAGGG - Intergenic
966274372 3:178147068-178147090 TTACATTTATTGTATTTGTATGG + Intergenic
967723516 3:192840152-192840174 GATCATCTTTTATATCTGCAGGG - Intronic
969929484 4:10616152-10616174 CTACATCTATTTTATCTGAATGG + Intronic
971540663 4:27812386-27812408 TAAAATCTATTATATCTGTCTGG - Intergenic
971654546 4:29326270-29326292 TCACATGTATTGTAATTGCAGGG + Intergenic
971842799 4:31875887-31875909 TAACATTTATTGTTTCTGCAAGG + Intergenic
972494469 4:39621153-39621175 TAACATTTATTTGATCTTCAGGG + Intronic
974504991 4:62758322-62758344 TAGTATCTATTGTATCTGTATGG - Intergenic
977406140 4:96601843-96601865 TAACATCTATTTAATCTTGATGG + Intergenic
977939034 4:102838281-102838303 TTATGTCTATTGTATCTGCATGG + Intronic
978038907 4:104033648-104033670 TAACAGCTATTGGATATTCAGGG + Intergenic
978750474 4:112240651-112240673 AAACATCTCTTTTATCTGCTTGG + Intronic
979475383 4:121150785-121150807 TAACAGATAATGAATCTGCATGG - Intronic
982702064 4:158668090-158668112 TAACATTTATTACATCTGCATGG + Exonic
982803033 4:159727809-159727831 TTGCATTTATTGTATCTACATGG + Intergenic
982917837 4:161235489-161235511 TAAAATCTTTTGTATTTTCAAGG + Intergenic
983253733 4:165375557-165375579 TTATGTCTATTGTATCTGTATGG + Intronic
983786816 4:171742086-171742108 TAATGTCTATTGTCTCTGTAAGG + Intergenic
984557389 4:181231149-181231171 TTACATCTACTCTCTCTGCATGG - Intergenic
984901514 4:184590718-184590740 TGACATCTATTATTTCTGCCGGG + Intergenic
987011021 5:13765051-13765073 TTACAAGTATTGTATCTACATGG + Intronic
988025584 5:25683866-25683888 TTAAATCTATTGTATCTGTATGG + Intergenic
990097814 5:52139896-52139918 TAACATCTATTGTCACAGGATGG + Intergenic
991425268 5:66484582-66484604 TAATATGTATTGCATCAGCAGGG + Intergenic
992137202 5:73758843-73758865 TAGCATGAATTGAATCTGCAGGG + Intronic
992174014 5:74132263-74132285 TTATTTCTTTTGTATCTGCATGG - Intergenic
992392955 5:76346178-76346200 TTACACCTATTGTATCTGTATGG - Intronic
993492804 5:88572303-88572325 TAACATAAAATGTATCTTCATGG + Intergenic
993596412 5:89862023-89862045 TTAGGTCTATTGTATCTGTATGG + Intergenic
994125542 5:96166158-96166180 TCACATCTGTTTTATCTGCAGGG - Intergenic
994369291 5:98950209-98950231 TTGTATCTATTGTATCTCCATGG + Intergenic
995564740 5:113422281-113422303 TTATATCTCTTGTATCTGTATGG - Intronic
995831074 5:116357053-116357075 TCACATCTACTCTATCTGCCTGG + Intronic
995985630 5:118168617-118168639 AAACAACTATTTTATCTTCAAGG + Intergenic
996999060 5:129737016-129737038 TGACATATATGATATCTGCATGG + Intronic
997044836 5:130302523-130302545 TAACATCTGTTGTATCTGTAGGG - Intergenic
997795971 5:136811402-136811424 TAACATCTTTTGTATCTGTGTGG + Intergenic
1001211404 5:169813337-169813359 TTACATCTATTGTGTCTGTGTGG + Intronic
1002156802 5:177288522-177288544 TAACATATTTTGAATCTGAATGG + Intronic
1002482714 5:179513947-179513969 TATCATCCAATGTATCTGTAGGG + Intergenic
1002982455 6:2153193-2153215 TAACCTTTGTTGTATCTGAAAGG - Intronic
1003610173 6:7606270-7606292 TAAAATCTATTTTCTCAGCATGG - Intronic
1005352753 6:24952549-24952571 TTACATCGATTGTATCTGGTTGG - Intronic
1005441327 6:25872201-25872223 TTACATCTCTTGTATCTATATGG + Intronic
1005856563 6:29867356-29867378 AAACCTCTTTTCTATCTGCAAGG + Intergenic
1006790805 6:36699766-36699788 TGGGATCAATTGTATCTGCATGG + Intronic
1007171382 6:39865880-39865902 TTACATGCATTGTATGTGCATGG + Intronic
1008127395 6:47684381-47684403 TTGCCTCTATTGTGTCTGCATGG + Intronic
1009939158 6:70269103-70269125 TAACATTTATTAAATCTGGATGG - Intronic
1010914198 6:81595519-81595541 AAGCATCTATTGTATATGCATGG - Intronic
1011106750 6:83790400-83790422 TGACATCTATTGTGTCTACATGG - Intergenic
1012097540 6:94982440-94982462 TTACATCTATTGTACCTGTATGG - Intergenic
1012244423 6:96910645-96910667 TAAAATCAATTGTATCTTAATGG + Intergenic
1013399642 6:109780184-109780206 TAACACCTATTGTATTTGCTAGG - Intronic
1015023257 6:128502784-128502806 TTACTTCTCTTGTATCTGTATGG + Intronic
1017344493 6:153364570-153364592 TTACATTTATGGAATCTGCAAGG - Intergenic
1018080288 6:160253780-160253802 TTACATCTACTGTATCTGCATGG + Intronic
1018774805 6:167004249-167004271 TAACTTCTTTTCTAGCTGCAAGG + Exonic
1021246165 7:18263916-18263938 TAAAATCTATTGTGTCAGCCAGG - Intronic
1022996462 7:35760549-35760571 AAACATCTGTTGTTTCTGGATGG - Intergenic
1023330507 7:39110411-39110433 TCACATTTATTGCATCTGCATGG + Intronic
1024418376 7:49134676-49134698 TAACCCCTGTTGTTTCTGCATGG + Intergenic
1025487531 7:61069788-61069810 AATCATCTATTGTACCTGAAAGG + Intergenic
1028117336 7:87014114-87014136 TAACATGTATTTTCTCTGTAAGG - Intronic
1029042867 7:97596375-97596397 TTATGTCTATTGTATTTGCATGG + Intergenic
1030090705 7:105855416-105855438 TACCATCTAATGTATCTGTATGG + Intronic
1030918805 7:115353152-115353174 TTACTTCTATTGTATCTATATGG + Intergenic
1031705176 7:124971927-124971949 TCTCATCTTTTGTCTCTGCATGG - Intergenic
1033161083 7:138997498-138997520 TTGCATCTATGGTATCTGAAAGG + Intergenic
1033256773 7:139808016-139808038 TTAGGTCTATTGTATCTGTAAGG - Intronic
1035488027 7:159244420-159244442 TTACATCTATAACATCTGCAGGG - Intergenic
1038294814 8:26281539-26281561 TCACATCTATTATATCTGTATGG - Intergenic
1041370775 8:57158335-57158357 TAAAATCTATTGTGTCCGAAAGG - Intergenic
1041466416 8:58162028-58162050 GGATATCTATTTTATCTGCAAGG - Intronic
1041488540 8:58406402-58406424 TTACATCTATTGGATCTATATGG - Intergenic
1044777134 8:95701743-95701765 TAACTACTATTATCTCTGCATGG + Intergenic
1045140113 8:99270884-99270906 TAACATCTACTGTGGTTGCAGGG - Intronic
1045674949 8:104597270-104597292 TAAGTTCTGTTGTATCTACAAGG - Intronic
1045852596 8:106720631-106720653 CAACATCAATTGTATCTGCATGG - Intronic
1046079923 8:109359726-109359748 TTATATGAATTGTATCTGCAGGG + Intergenic
1047430485 8:124786933-124786955 TAATGTCCACTGTATCTGCACGG - Intergenic
1050146747 9:2576222-2576244 TAGCATTTATTTTATCTTCAGGG + Intergenic
1052170102 9:25383697-25383719 TGACATCTATTGTGTCTGTAGGG + Intergenic
1053317049 9:37060748-37060770 TTACCTCTATTTTATCTGTATGG - Intergenic
1056568360 9:87794699-87794721 CAACATGAATTGTTTCTGCAGGG + Intergenic
1186270194 X:7878582-7878604 TCACATCTTTGGTATCTCCAAGG + Intergenic
1186790172 X:12989878-12989900 TTACATCTACTATATCTGTATGG + Intergenic
1186995181 X:15113883-15113905 TTACATCTATTTTATCTGTATGG + Intergenic
1187892550 X:23949925-23949947 TTATATCTATTGTATCTGTATGG + Intergenic
1190436584 X:50431632-50431654 GAACATCTATTGTCTTTGCTTGG + Intronic
1190856939 X:54305264-54305286 TTACAGCTACTCTATCTGCATGG + Intronic
1191175470 X:57496094-57496116 AAACATCTATTTTCTCTGTATGG - Intergenic
1192579020 X:72265448-72265470 TCACACCTGCTGTATCTGCATGG + Intronic
1192708658 X:73556359-73556381 TACCATCTATTCTCTCTGAAGGG - Intergenic
1193730859 X:85101209-85101231 TAAAATCTTTTGTATGTGAAAGG + Intronic
1194251386 X:91579592-91579614 TAACATTTATTGTAGGTTCAGGG + Intergenic
1195067581 X:101251545-101251567 TAACATCTATTGTATCTGCATGG - Intronic
1195982441 X:110593698-110593720 TTACATCTATTGTATCTGAATGG - Intergenic
1197158414 X:123295732-123295754 AAACATCTATTGTTTCTGATTGG + Intronic
1197573249 X:128176286-128176308 TAACATTTATTTTAGCTTCAGGG - Intergenic
1198226371 X:134649364-134649386 TTACATCTATTGTATCTGTATGG + Intronic
1200570327 Y:4820823-4820845 TAACATTTATTGTAGGTTCAGGG + Intergenic
1201013079 Y:9569192-9569214 TAAAATGTATTGATTCTGCAGGG + Intergenic