ID: 1195068117

View in Genome Browser
Species Human (GRCh38)
Location X:101255543-101255565
Sequence CTGCAACTTCAGATGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195068117 Original CRISPR CTGCAACTTCAGATGAGGGA GGG (reversed) Intronic
901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG + Intronic
901184565 1:7364620-7364642 CTGCAGCTGCAGATATGGGATGG + Intronic
901712473 1:11126542-11126564 CAGTAATTTCAGAAGAGGGAAGG + Intronic
901909033 1:12439430-12439452 CTGCAATTTTAGATGGGGGAGGG - Intronic
904396717 1:30227389-30227411 CCCCAACTACAGATGAGGAAAGG + Intergenic
904622010 1:31781424-31781446 CTGCACGTCCAGAGGAGGGAGGG + Intergenic
905387718 1:37615721-37615743 CTGCATCTACAGAGAAGGGATGG + Intronic
909284490 1:73797668-73797690 CTGCATCATCACATGATGGAAGG - Intergenic
909466578 1:75980133-75980155 CAGCAGCTGCTGATGAGGGATGG + Intergenic
911756572 1:101563877-101563899 ATGCAAGTCCATATGAGGGAAGG + Intergenic
913017150 1:114750143-114750165 CTTCAAGTTCAGATCAGGCAAGG - Exonic
914585763 1:149060346-149060368 CTGGAAGCCCAGATGAGGGATGG - Intronic
916839458 1:168584799-168584821 CAGCATGCTCAGATGAGGGATGG + Intergenic
918103793 1:181399110-181399132 CTACAACTTCAGAGGAAGGACGG - Intergenic
918400350 1:184156634-184156656 CTGCCCCCTCAGATGAGGGCTGG - Intergenic
919137886 1:193533326-193533348 CTCCAATTTAATATGAGGGAAGG - Intergenic
921169404 1:212533161-212533183 CTTCAAATTCAGCTTAGGGATGG + Intergenic
922728204 1:227935771-227935793 GTGCAACTTCAGATGAGCAGAGG - Intronic
1063425808 10:5949241-5949263 CTGCAAGTCAGGATGAGGGACGG + Intronic
1063426292 10:5952728-5952750 CTGAAAGTTAGGATGAGGGACGG + Exonic
1063579161 10:7290165-7290187 CTGCAATTTCAGGTGGAGGAAGG + Intronic
1063912763 10:10848996-10849018 TTGCAATTTCAGAAGAAGGACGG - Intergenic
1063942954 10:11149397-11149419 CTGCATCTGCTGATGAGGGTGGG - Intronic
1064488206 10:15819689-15819711 TTCCAACTGCAAATGAGGGAGGG - Intronic
1065906905 10:30263038-30263060 CTGCAATTTCAGATGAGATTTGG - Intergenic
1066573040 10:36793758-36793780 GTGCAACTTCACATGTGGCAAGG + Intergenic
1067102783 10:43344953-43344975 ATGGAACTTCTGATGTGGGATGG + Intergenic
1068567430 10:58591458-58591480 CTGTAACCTCACATGATGGAAGG + Intronic
1069587696 10:69619505-69619527 CTGCATCTTCACATGGTGGAAGG + Intergenic
1069720215 10:70544958-70544980 CTGCCACTTAAGAACAGGGAAGG - Intronic
1070553172 10:77507431-77507453 CTGCAAGTTCAGCTCTGGGATGG - Intronic
1071501029 10:86204531-86204553 CTGCATCTTGAGAAGAGTGAGGG + Intronic
1072295288 10:94003673-94003695 GTGCAGCTTCAGATGTGGTAAGG + Intronic
1072589921 10:96819843-96819865 CTGCATCTTCACATGGTGGAAGG + Intergenic
1072958078 10:99904503-99904525 CTGAAACATCCGATGAGGGAAGG - Intronic
1074243595 10:111664866-111664888 CAGTGACTTTAGATGAGGGAAGG - Intergenic
1078775071 11:14386240-14386262 CTGCAACCTCACATGTGGAAGGG - Intergenic
1078824594 11:14916908-14916930 CTGTATCTTCACATGATGGAAGG + Intronic
1079558743 11:21794514-21794536 CTGCAACTTCTGGTGAGTCATGG - Intergenic
1079753739 11:24229785-24229807 CTGCTACTTGAGATCATGGAGGG - Intergenic
1082006111 11:47420016-47420038 CTGTGCCTTCAGATGAGGGGTGG + Intronic
1085722957 11:78929369-78929391 CAGCAACTTCAGAGGTGGGAGGG + Intronic
1087483637 11:98733609-98733631 CTGCTACTTGAGATAATGGAGGG - Intergenic
1089572396 11:119419268-119419290 CTGGAACTCCTGATGAGGGGTGG + Exonic
1090621814 11:128567226-128567248 CTGGAACTGCACAGGAGGGACGG + Intronic
1090803515 11:130188858-130188880 CAGCAGCTTCAGCTGAGGAAGGG - Exonic
1091322736 11:134663463-134663485 CTGTAACCTCAAATAAGGGAGGG + Intergenic
1092018134 12:5176706-5176728 TTCCAACTTTAGATTAGGGATGG - Intergenic
1092182039 12:6452588-6452610 CTGACACTTCAGAAGAGGAAAGG + Intronic
1092293348 12:7178737-7178759 CTGCATCTTCACATGGTGGAAGG - Intergenic
1093196723 12:16138460-16138482 CTGCATCATCCCATGAGGGAGGG + Intergenic
1093915415 12:24797000-24797022 CTGCCACTTCAGATAACGCAAGG - Intergenic
1095573874 12:43712644-43712666 CTGAAACTTGAGAAGAGGGAGGG + Intergenic
1095701275 12:45193570-45193592 CAGGAAGTTCAGGTGAGGGAAGG - Intergenic
1096602202 12:52737213-52737235 AAGCAACTTCAGGTCAGGGAGGG - Intergenic
1097611385 12:61825539-61825561 CTGCACTTTCAGATGAGTGTTGG + Intronic
1098182601 12:67863859-67863881 CTGCATCTTCATATGGCGGAGGG + Intergenic
1098231288 12:68374264-68374286 CTACTTCTTCAAATGAGGGAGGG - Intergenic
1101030282 12:100651490-100651512 GTGGAATTTCAGAAGAGGGAGGG - Intergenic
1101605451 12:106245244-106245266 GTGAAAGTTCAGAAGAGGGAGGG - Intronic
1101834538 12:108286291-108286313 CTGCAGCCTCAGATGAGCCATGG - Intergenic
1102949486 12:117020751-117020773 CTGCGACTTCAGGGGAGGGGAGG - Intronic
1104218952 12:126763404-126763426 CTGCACCTGCAGGTGAGGCAAGG - Intergenic
1104744549 12:131202759-131202781 GTGCATTTTCAGGTGAGGGACGG + Intergenic
1104789834 12:131474448-131474470 GTGCATTTTCAGGTGAGGGACGG - Intergenic
1106027755 13:25971495-25971517 CTGAAAGATCAGATGAGGGTAGG - Intronic
1106868890 13:33997232-33997254 GTGTAACTTCAGAAGAGAGAAGG - Intergenic
1112490686 13:99860614-99860636 CTTTAACTTAAGATGGGGGAGGG + Intronic
1113610034 13:111638026-111638048 GTGCAACTTCTCAGGAGGGAGGG + Intronic
1113932678 13:113976590-113976612 CTGCAACTGAAGATGAGGTTTGG + Intergenic
1114377440 14:22163330-22163352 CTGCATCTTCACAGGAGGGATGG + Intergenic
1117679208 14:58185839-58185861 CTGCAACCTCACATGGTGGAAGG - Intronic
1119832081 14:77712308-77712330 CTGCAACTCCAGCTTAGGCAAGG - Intronic
1124225349 15:27888922-27888944 CTGCTTCCTCACATGAGGGAAGG - Intronic
1125241553 15:37582441-37582463 CCCCACCTTCAGACGAGGGAAGG + Intergenic
1125427152 15:39560586-39560608 CAGCAACTCCAGATGTGGCACGG - Intergenic
1125678850 15:41517972-41517994 CTCCATCTTCAGAGGAAGGAAGG - Intronic
1127998696 15:64171324-64171346 GTGTAACTTCACAGGAGGGAGGG + Exonic
1128350582 15:66885752-66885774 CTGTAACCTCAAATGAAGGAAGG + Intergenic
1128826459 15:70722052-70722074 CTGAAAACTCAGATAAGGGATGG + Intronic
1129114941 15:73360075-73360097 CTGCATCTTCAGAAAGGGGAAGG + Intronic
1130940963 15:88508681-88508703 CTGCAGTTTCAGAGGAGGGGTGG + Intergenic
1133466719 16:6034497-6034519 CTGCATCTTCATATGGTGGAAGG + Intronic
1143665857 17:8359673-8359695 CTGCACCTACAGATGAAGAAGGG + Intergenic
1144146124 17:12399431-12399453 CTGCAACCTCACATGGTGGAAGG - Intergenic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1145304870 17:21668275-21668297 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1145975004 17:28978810-28978832 CTGCATCATCAGGGGAGGGATGG + Intronic
1146476044 17:33163486-33163508 CTGCCACTGCTGATGGGGGAGGG + Intronic
1147896224 17:43753165-43753187 CTGGAACCTCAGAGGAGAGAGGG + Intergenic
1148150845 17:45395842-45395864 CTGCAACTCTGGGTGAGGGAAGG + Exonic
1148537654 17:48454198-48454220 CTGCTTCTTCACATGATGGAAGG + Intergenic
1151033439 17:70770440-70770462 CTGCTACTGCACATGAGGAAAGG + Intergenic
1151459168 17:74244442-74244464 CAGCAGCTTCTGATGCGGGAGGG - Intronic
1151603692 17:75122978-75123000 CTGTAATTTAAGATGAAGGAGGG - Intronic
1151771428 17:76164883-76164905 ATGAAACTGCAGATCAGGGAGGG - Intronic
1151979911 17:77502660-77502682 CAGGAACTTCAGATGGGGGATGG - Intergenic
1152368344 17:79870281-79870303 CTCCAACCTCAGAAAAGGGACGG - Intergenic
1152435372 17:80273218-80273240 CTGTAACGGCAGATGAAGGAAGG - Intronic
1153441290 18:5122403-5122425 CTGCAGCTTGACGTGAGGGAGGG + Intergenic
1154171835 18:12057720-12057742 CTGCATCTTCAGGTCAGGCATGG + Intergenic
1155223595 18:23708065-23708087 ATTCAACTTCAGATGAAGTAAGG - Intronic
1155992051 18:32287902-32287924 CTGGAACTTCAGATGCAAGAGGG - Exonic
1156022563 18:32616736-32616758 GTGCAGTTTCAGATTAGGGATGG + Intergenic
1156649680 18:39210706-39210728 CAGCAACTCCAGATGAGAGATGG + Intergenic
1157865660 18:51181977-51181999 GTGAAACTGCAGATAAGGGAGGG - Intronic
1158753159 18:60289903-60289925 CTACAACTTTAGAGTAGGGATGG - Intergenic
1160625727 18:80203622-80203644 CAGCAACCACAGATGAGGCAAGG - Intronic
1160668011 19:342354-342376 CTGCAACTGCGGGTCAGGGAAGG + Intronic
1161121106 19:2527329-2527351 CTGCACCCCCAGATGAGGGCCGG - Intronic
1161679957 19:5675063-5675085 CTGCAAGGTGAGATGAGGCAGGG + Intronic
1162788971 19:13053424-13053446 CTGCAACTGCAGAGGGGGGAAGG + Intronic
1163418784 19:17202721-17202743 ATGCCACTCCAGGTGAGGGAGGG + Intronic
1164946686 19:32300400-32300422 CTGTAACTTCACATGGAGGAAGG - Intergenic
1166917686 19:46206800-46206822 CTGCAGCTTCAGGAGAGGGGAGG + Intergenic
925716506 2:6788845-6788867 TTGCAATTTCAGATGAGGTTTGG - Intergenic
926354003 2:12023190-12023212 CTACAATTTCAGATGAGATACGG - Intergenic
927627786 2:24741912-24741934 CTGGTAGTCCAGATGAGGGAGGG - Exonic
928653112 2:33422584-33422606 CTGCATCTTCACATGGTGGAAGG - Intergenic
928666023 2:33551383-33551405 CTGAAAATTCTGATGTGGGATGG + Intronic
928787702 2:34909512-34909534 CAGCAACTTCAGAAAAGGCAGGG + Intergenic
928999068 2:37327828-37327850 CTTCAAGTTCAGAAAAGGGAAGG - Intergenic
929160227 2:38824611-38824633 CTGCAACTTCAGATGTGAGAAGG - Intronic
929420285 2:41783418-41783440 GTCCAACTTCAGATGACTGATGG - Intergenic
932103072 2:68918597-68918619 CTGCCATTTCAGAGAAGGGACGG - Intergenic
932262932 2:70342195-70342217 CTATAACTTGAGAAGAGGGAAGG + Intergenic
932495662 2:72144670-72144692 CAGCAACTACAGATGGGGGTTGG + Intronic
933161126 2:79026305-79026327 CTGCAAGTTAACATGAAGGAAGG - Intronic
939255078 2:139732871-139732893 CTGCAGGTTCAGATGAGGCTAGG - Intergenic
939770322 2:146308025-146308047 CTGCAAACTCAGGTGAGAGAAGG + Intergenic
940106664 2:150108849-150108871 CTGTATCTTCAGTTGAAGGATGG + Intergenic
940158060 2:150680383-150680405 CTGCATCCTCACATGATGGAAGG + Intergenic
941821018 2:169843316-169843338 CTGCATCTTCACATGGTGGAAGG + Intronic
941883232 2:170502624-170502646 ATGCAGCTTCAAATGAGGGAAGG - Intronic
943664920 2:190599423-190599445 CTATAACTTCAGATGAGTTATGG + Intergenic
945455339 2:210046067-210046089 CTGTAACCTCAAATGATGGAAGG + Intronic
946289548 2:218733710-218733732 CTGCAGCTTCTGAGGAGGGTAGG + Intronic
946498586 2:220221316-220221338 CTGCAACTCCAGCTGACCGAGGG + Intergenic
948283171 2:236764293-236764315 CTGCTACTTCAGATCAGAGAAGG - Intergenic
948898466 2:240941949-240941971 CTGCACCTTCACATGGTGGAAGG - Intronic
1169301440 20:4445171-4445193 CTGCATCATCAGATGGTGGAAGG - Intergenic
1171464792 20:25319882-25319904 CTGCAGCTCCAGATAGGGGACGG + Intronic
1171522379 20:25785715-25785737 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171530128 20:25847660-25847682 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171554448 20:26070168-26070190 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1173404581 20:42753576-42753598 CTGCCACTCCAGCTTAGGGAGGG - Intronic
1173677837 20:44853151-44853173 CTGCATCTTCACATGGTGGAAGG + Intergenic
1177007138 21:15687362-15687384 CTGCATCTTCACATGACAGAGGG - Intergenic
1177255181 21:18652315-18652337 CTGCATCTTCATATGGTGGAAGG - Intergenic
1179716237 21:43290199-43290221 TTGAACCTTCAGATCAGGGAGGG + Intergenic
1182524765 22:30908202-30908224 CTGCACTTCCAGGTGAGGGATGG + Intergenic
1183353668 22:37347332-37347354 CTGCAGCTTCAGATTTGGAAAGG - Intergenic
1184791168 22:46701057-46701079 CTGTGACTTCAGGTGAGGCACGG + Intronic
949765487 3:7521466-7521488 CTGTGACTTCACATGATGGAAGG - Intronic
951503269 3:23414406-23414428 CTGAAAGCTCAAATGAGGGAAGG - Intronic
952344941 3:32474366-32474388 CTCTGACTTCAGATGAGAGAAGG + Intronic
953882056 3:46695701-46695723 CTGCACGTGCAGCTGAGGGAAGG + Intergenic
954385652 3:50242517-50242539 CTGCACCTGTAGCTGAGGGAAGG - Intronic
954849856 3:53591032-53591054 CTGCAACTGCACAGGAGGAAAGG - Intronic
955088772 3:55729072-55729094 CTGCAGCCTCAGAACAGGGAGGG - Intronic
956571862 3:70705569-70705591 CTGCATCCTCACATGGGGGAAGG + Intergenic
957643931 3:82895230-82895252 CTGCAATTACCAATGAGGGAAGG + Intergenic
958574191 3:95926606-95926628 CTGCAATTTCACAAGAGAGAAGG + Intergenic
959373535 3:105559489-105559511 CTGTAACTTCACATGATGGCAGG + Intronic
959886674 3:111510451-111510473 CTGCATCTTCACATGGAGGAAGG + Intronic
961110814 3:124281582-124281604 CTGGACCTTCAGCTGGGGGAGGG - Intronic
963552972 3:146747859-146747881 CTGCAGATTCAGTTCAGGGAAGG + Intergenic
965465849 3:169029866-169029888 GTGAAACTGCAGATAAGGGAAGG - Intergenic
966809562 3:183831453-183831475 CTGGAGTTTCAGATGAGGGCTGG - Intronic
971938837 4:33188858-33188880 CTCCACCTTCAGACCAGGGAGGG - Intergenic
972383311 4:38539587-38539609 CTGCAAGTTCAGGATAGGGATGG + Intergenic
972463453 4:39328843-39328865 CTGCAGTTTCAGATGAGATACGG + Intronic
972634360 4:40870255-40870277 CTGCCAGTGCAGATGAGGGAGGG + Intronic
973176548 4:47212848-47212870 CTGCAGGTTCAGACTAGGGAGGG - Intronic
973208490 4:47587674-47587696 CTGCACCTTCAGATGGTGGAAGG + Intronic
974126803 4:57706811-57706833 CTGCAAATTCAGGTGAGAGGGGG + Intergenic
975265205 4:72355633-72355655 CTGCATCCTCACATGATGGATGG - Intronic
975394490 4:73859038-73859060 CTCCAACCCCAGGTGAGGGATGG - Intergenic
975474476 4:74807425-74807447 CTGCAACTTCAGTTGAAAGAAGG + Intergenic
975487498 4:74950295-74950317 CTGGAGCTTCAGAGGAGGCATGG - Intronic
976319050 4:83690721-83690743 CTGCATCTTCACATGATGGAAGG + Intergenic
978229925 4:106385937-106385959 CTCCAACTTCAGGCCAGGGAAGG - Intergenic
978270332 4:106881816-106881838 CTGAAACTTCAGATGGGAAATGG - Intergenic
982270700 4:153583738-153583760 CTACAACTACAGATTAGGCATGG + Intronic
982440544 4:155430889-155430911 GTGCTATTTCAGATGTGGGAAGG + Intergenic
983109878 4:163736525-163736547 CTGAAACTGCAGATAAGGGTTGG + Intronic
984233054 4:177122968-177122990 CAGCAACTTCAGTTGACGGTAGG + Intergenic
986041278 5:3996376-3996398 GTGCAGCGTCAGATGGGGGAGGG + Intergenic
986230850 5:5863755-5863777 CTGTAACCTCACATGATGGAGGG - Intergenic
986428528 5:7658216-7658238 CAGAAACTTCAGTTGAGGAAAGG - Intronic
988368089 5:30328602-30328624 CTGTAACTTCACATGACAGAAGG + Intergenic
990494220 5:56330961-56330983 CTGCAGATTCAGATGTGGGAGGG + Intergenic
992220170 5:74563973-74563995 CTTCAACTACAGATGAGGACAGG + Intergenic
994699307 5:103113401-103113423 CTGTAACTTCACATGAGGGAAGG + Intronic
994764660 5:103900893-103900915 CTGCAATTTAAGATGAGAGTTGG - Intergenic
997361464 5:133297900-133297922 CTGCTGGTCCAGATGAGGGATGG - Intronic
998031526 5:138873816-138873838 CAGCAACTTGACATGTGGGATGG - Exonic
1002579394 5:180198561-180198583 CTGCATCTTCACATGGGGGAAGG + Intronic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1004228670 6:13811977-13811999 CTCCAACCCCTGATGAGGGAAGG + Intronic
1006404960 6:33839599-33839621 CAGCAGCTTCAGACGATGGATGG + Intergenic
1006437726 6:34034979-34035001 CTGCAACTCCAGCCAAGGGAAGG + Intronic
1008496577 6:52140037-52140059 CTGGAACTTCAGGGGAGGGGAGG - Intergenic
1009444313 6:63722497-63722519 TTGCAACTTCAGATGCTGGATGG - Intronic
1009649760 6:66460200-66460222 CTGCAACATAACATGATGGAAGG - Intergenic
1009899828 6:69797142-69797164 CTGCAAGCTGAGATGTGGGAGGG + Intergenic
1010059547 6:71606797-71606819 CTGCAATTTCTGGTGTGGGATGG + Intergenic
1013594347 6:111647259-111647281 CTGTAACTTCAGCTAAGGTAGGG + Intergenic
1014176413 6:118336166-118336188 CTGCAACTTCAGATCTTTGAGGG - Intergenic
1018034925 6:159873757-159873779 ATGCCACTGCAGTTGAGGGAGGG + Intergenic
1023263963 7:38385926-38385948 ATTCCAGTTCAGATGAGGGATGG + Intronic
1023780253 7:43648451-43648473 CTTTAACTTCACAGGAGGGATGG - Intronic
1025282866 7:57640892-57640914 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1025301849 7:57824526-57824548 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1026819608 7:73537984-73538006 CAGCAACTTCCGAGGAGGGCAGG + Exonic
1028367534 7:90050993-90051015 TCTCAACTTCAGATGGGGGAGGG + Intergenic
1030985239 7:116233839-116233861 CTGCATCTTCACATGGAGGAAGG + Intronic
1030989745 7:116286101-116286123 ATTCAACTTCAGGTGAGTGATGG - Intergenic
1031023432 7:116652987-116653009 ATCCACCTTCAGAGGAGGGATGG - Intergenic
1031090633 7:117349542-117349564 CTGCTGCTTCAGATGAGATATGG - Intergenic
1031555889 7:123175561-123175583 CTGCATCCTCACATGATGGAAGG - Intronic
1031677594 7:124630605-124630627 CTGCAAATTAAGATGACAGATGG + Intergenic
1031887252 7:127254707-127254729 CTGCAACCACAAAAGAGGGAGGG + Intergenic
1033495420 7:141889114-141889136 GGCCAGCTTCAGATGAGGGAGGG + Intergenic
1034114557 7:148572228-148572250 CTGCAAAGTAAGATGAGGGTGGG + Intergenic
1035050964 7:155998908-155998930 CTGCAGCCTCCGAGGAGGGACGG - Intergenic
1035114792 7:156515643-156515665 GAGCTACGTCAGATGAGGGAAGG + Intergenic
1036009393 8:4704505-4704527 CTGAAACATCAGATTAGGAAGGG - Intronic
1037439803 8:18903834-18903856 CTCCAACTTAGGCTGAGGGAAGG + Intronic
1037937303 8:22923795-22923817 CTGCGACTTCACATGGGGGAAGG - Intronic
1039781994 8:40794957-40794979 CTGGAAGCTCAGAAGAGGGAGGG + Intronic
1039797862 8:40930767-40930789 CTGCATCTTCAGGTGAGAGATGG - Intergenic
1045115650 8:98977409-98977431 CTGCATCATCCGATGATGGAAGG + Intergenic
1045186569 8:99844321-99844343 CTGTAACCTCACATGATGGAAGG + Intronic
1045287142 8:100801668-100801690 CTGCAATTTCATATGAGGCTTGG - Intergenic
1045886743 8:107107690-107107712 CTGCAACTTCACATTATGGGAGG + Intergenic
1046313097 8:112464519-112464541 ATGTAACTTCAGAGGAGGGAAGG - Intronic
1047616206 8:126564470-126564492 CTTGACCTTCAGATGAAGGAAGG + Intergenic
1048553418 8:135454746-135454768 CTGCCAACTCAGATCAGGGAGGG + Intergenic
1049151272 8:141036983-141037005 CTGCAACTGCAGAGATGGGAGGG + Intergenic
1049178816 8:141209939-141209961 CTGGGCCTTCAGATGAGGGTGGG + Intronic
1049291216 8:141803338-141803360 CTGCATCCTCACATGATGGAAGG + Intergenic
1050013308 9:1207788-1207810 CACCACCTTCAGATGAGTGATGG + Intergenic
1054919499 9:70527855-70527877 CTGCAGCCTCACATGGGGGAAGG - Intergenic
1056202247 9:84288179-84288201 CTGCAATTTCAGAAGAAAGAAGG + Intronic
1056853334 9:90103180-90103202 CTGCACCTTCACATGGTGGAAGG - Intergenic
1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG + Intergenic
1057388992 9:94627564-94627586 CTAGAACTTCAGACGGGGGATGG - Intronic
1058280116 9:103103518-103103540 CTCCACCTTCAGACCAGGGAAGG + Intergenic
1058704660 9:107628380-107628402 GTACAAATACAGATGAGGGACGG + Intergenic
1059402013 9:114076513-114076535 CTGCAACTTCCCAGGATGGACGG + Intronic
1061941810 9:133887822-133887844 TTGCATCTTCAGGGGAGGGAAGG + Intronic
1062228954 9:135470498-135470520 CCGCAACTTCAGGAGAAGGATGG - Intergenic
1062725063 9:138068237-138068259 CTGCATCTGCAGAGGAGGAAGGG + Intronic
1185561657 X:1064560-1064582 TTTCAAGTTCAGATGAGGAACGG + Intergenic
1189440756 X:41033678-41033700 CTGCCACTGCAGAAAAGGGAGGG + Intergenic
1190955481 X:55188780-55188802 CTGTACCTTAAGATGAGGAAAGG - Intronic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1194011737 X:88570032-88570054 CTGCAACTCCAAATGAGGTAAGG - Intergenic
1194131940 X:90092167-90092189 CAGCCACTTCAAATGAAGGATGG + Intergenic
1194641278 X:96406445-96406467 CGGCCACCTCAGATGAGAGATGG - Intergenic
1195068117 X:101255543-101255565 CTGCAACTTCAGATGAGGGAGGG - Intronic
1195112686 X:101663728-101663750 CTGGAAATGAAGATGAGGGAGGG - Intergenic
1195617729 X:106926371-106926393 CTGGAAATTCAGATTTGGGAGGG + Intronic
1197876583 X:131115077-131115099 CTTCCACTTGAGAAGAGGGAAGG - Intergenic
1198138926 X:133783175-133783197 CCGGAAGTTCAGATCAGGGATGG - Intronic
1198267230 X:135021406-135021428 CTGCAAATTCAGAAGAGAAATGG + Exonic
1198881902 X:141291109-141291131 CTGCATCTTCACATGGTGGAAGG + Intergenic
1202019214 Y:20447944-20447966 CTGCTACCTGAGATGAGGGAGGG + Intergenic