ID: 1195068752

View in Genome Browser
Species Human (GRCh38)
Location X:101260184-101260206
Sequence ATGGAGAAAGGGGCTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1323
Summary {0: 1, 1: 0, 2: 8, 3: 169, 4: 1145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195068752_1195068768 24 Left 1195068752 X:101260184-101260206 CCTTTCCCAGCCCCTTTCTCCAT 0: 1
1: 0
2: 8
3: 169
4: 1145
Right 1195068768 X:101260231-101260253 TGCCCAAGGCTTTGCGGGGCTGG 0: 1
1: 0
2: 3
3: 12
4: 189
1195068752_1195068769 25 Left 1195068752 X:101260184-101260206 CCTTTCCCAGCCCCTTTCTCCAT 0: 1
1: 0
2: 8
3: 169
4: 1145
Right 1195068769 X:101260232-101260254 GCCCAAGGCTTTGCGGGGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 188
1195068752_1195068765 19 Left 1195068752 X:101260184-101260206 CCTTTCCCAGCCCCTTTCTCCAT 0: 1
1: 0
2: 8
3: 169
4: 1145
Right 1195068765 X:101260226-101260248 TTTCCTGCCCAAGGCTTTGCGGG 0: 1
1: 0
2: 0
3: 20
4: 186
1195068752_1195068772 30 Left 1195068752 X:101260184-101260206 CCTTTCCCAGCCCCTTTCTCCAT 0: 1
1: 0
2: 8
3: 169
4: 1145
Right 1195068772 X:101260237-101260259 AGGCTTTGCGGGGCTGGGACTGG 0: 1
1: 0
2: 3
3: 21
4: 413
1195068752_1195068764 18 Left 1195068752 X:101260184-101260206 CCTTTCCCAGCCCCTTTCTCCAT 0: 1
1: 0
2: 8
3: 169
4: 1145
Right 1195068764 X:101260225-101260247 ATTTCCTGCCCAAGGCTTTGCGG 0: 1
1: 0
2: 0
3: 15
4: 231
1195068752_1195068766 20 Left 1195068752 X:101260184-101260206 CCTTTCCCAGCCCCTTTCTCCAT 0: 1
1: 0
2: 8
3: 169
4: 1145
Right 1195068766 X:101260227-101260249 TTCCTGCCCAAGGCTTTGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 142
1195068752_1195068761 10 Left 1195068752 X:101260184-101260206 CCTTTCCCAGCCCCTTTCTCCAT 0: 1
1: 0
2: 8
3: 169
4: 1145
Right 1195068761 X:101260217-101260239 TGCCCTCGATTTCCTGCCCAAGG 0: 1
1: 0
2: 1
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195068752 Original CRISPR ATGGAGAAAGGGGCTGGGAA AGG (reversed) Intronic
900491779 1:2952897-2952919 AGAGAGAGAGGGGCTGGAAATGG - Intergenic
900581792 1:3413148-3413170 CTGGAGAGAGGGGTGGGGAAGGG - Intronic
900608500 1:3534616-3534638 CTGGAGCAAAGGGCCGGGAAGGG - Intronic
900623129 1:3596493-3596515 GTGGAGACGGGGGCTGGGCAGGG - Intronic
900623148 1:3596537-3596559 GTGGAGACGGGGGCTGGGCAGGG - Intronic
900623167 1:3596581-3596603 GTGGAGACGGGGGCTGGGCAGGG - Intronic
900623185 1:3596625-3596647 GTGGAGACGGGGGCTGGGCAGGG - Intronic
900623203 1:3596669-3596691 GTGGAGACAGGGTCTGGGCAGGG - Intronic
900623220 1:3596713-3596735 GTGGAGACGGGGGCTGGGCAGGG - Intronic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
900700307 1:4044203-4044225 AAGAAGAAAGAGGCTGGGCACGG - Intergenic
900794760 1:4701182-4701204 CTGGGGAAAGGGGATGGGAGTGG + Intronic
900982129 1:6051811-6051833 ATGTATAAAAGGGCTGGGCACGG + Intronic
901064216 1:6486960-6486982 ATGGGGAAAGAGGGTGGGAAGGG + Intronic
901192208 1:7419445-7419467 AAGGAGATTGGGGCTGGGCATGG - Intronic
901280523 1:8030574-8030596 ATGGAAAAATGGGCTGGGCATGG - Intergenic
901523068 1:9800427-9800449 ATACATAAAGGGGCTGGGCATGG + Intronic
901754478 1:11433077-11433099 GGGGAGAAAGGAGGTGGGAAGGG - Intergenic
901787092 1:11631984-11632006 AGGGAGGAAGGGGAAGGGAAGGG + Intergenic
901920941 1:12537204-12537226 AAGGAGAGAGTGGCTGGGCACGG - Intergenic
902069304 1:13720344-13720366 ATGGAGAGAAGGGCTGGGTAGGG + Intronic
902082963 1:13833750-13833772 AGGAAGAGAGGGGGTGGGAAGGG + Intergenic
902441555 1:16433437-16433459 AATGAGAAAGAGGCTGGGGAGGG - Intronic
902570966 1:17346795-17346817 TTGGAGATGGGGGATGGGAATGG - Intronic
902606507 1:17572268-17572290 ATGGAGCAGGGGGCTGAGGAGGG - Intronic
902630210 1:17700381-17700403 CTGGAGAAGGGGGATGGGAAGGG + Intergenic
903021359 1:20397542-20397564 AAGGAGAAGGGGGCTGGAAATGG + Intergenic
903319680 1:22535198-22535220 ATGGACAGAGGGGACGGGAAAGG - Intergenic
903383440 1:22912032-22912054 ATGGAGAATGGCACTGGGAGAGG + Intronic
903475666 1:23617680-23617702 ATGGACAAAGGGGGAGGAAAGGG - Intronic
903797661 1:25941998-25942020 AGGGATAAAGGGGCTGGGCTAGG + Intergenic
903834982 1:26197902-26197924 AGGAGGGAAGGGGCTGGGAAGGG + Intronic
903886201 1:26542512-26542534 ACGTAGAAAGGGGCTGGGCCTGG + Intronic
903964332 1:27077047-27077069 AGGGAAGAAGGGGATGGGAAGGG - Intergenic
904285229 1:29449660-29449682 ATGGAGTGAGGGGCTGTGGATGG + Intergenic
904379448 1:30101239-30101261 AAGGAGGAAGGGCCTGGGGAGGG + Intergenic
904473003 1:30747469-30747491 AAGGAGAGTGGGGGTGGGAAGGG - Intronic
904583893 1:31568455-31568477 ATGGAGAGAGGGTAAGGGAACGG - Intergenic
904677953 1:32209900-32209922 AGGGAGTAAGTGGCTGGGCACGG + Intronic
904810030 1:33157474-33157496 ATAAGGAAGGGGGCTGGGAAAGG - Intronic
905209844 1:36366536-36366558 TTGGAGGATGGGGCAGGGAAAGG - Intronic
905256579 1:36688854-36688876 AAGGGGAAAGGGTGTGGGAAGGG + Intergenic
905889213 1:41509301-41509323 GTGGAGACAGGGGCAGGGACGGG + Exonic
906036302 1:42752223-42752245 GTGGAGAAAGGGGTGGGGAAGGG - Intronic
906156558 1:43617413-43617435 ATGGAGAAAGCGGGTGGGGTGGG - Intronic
906264649 1:44418691-44418713 ATGAGGAAAGGGGGTGGGGAGGG - Intronic
906289454 1:44610414-44610436 ATGGGGACAGGGACTGGGATGGG - Intronic
906411951 1:45585518-45585540 ATGGGGAAAGAGGCAGGTAATGG - Intronic
906667848 1:47634116-47634138 ATGGAGTAAAGGGCAGGGAAAGG - Intergenic
906714258 1:47955291-47955313 AAGGAGAAAGGGACTGGGGAAGG - Intronic
907052006 1:51335981-51336003 CTGGGGGAAGGGGCTGGGAGGGG - Intronic
907052291 1:51337715-51337737 AAATAGAAAGGGGCTGGGCACGG - Intronic
907109967 1:51918204-51918226 CAGGAGAAAGGGGTTGGGATCGG + Exonic
907303493 1:53502032-53502054 AGGGACAAAGGGGCTTGGAAGGG + Intergenic
908109935 1:60886930-60886952 CTTGAGAAAGGGGCTGGGAGGGG + Intronic
908145309 1:61235170-61235192 ATGAACAAAGGGGCTGGGCGCGG + Intronic
908295345 1:62707225-62707247 ATAGGGAAGGGGGCTGGGGAGGG + Intergenic
908598437 1:65712282-65712304 AAGGACAAAGGGGCTGGGCACGG - Intergenic
908739717 1:67314752-67314774 ATGGGGAAAGAGGCTGGTCAGGG + Intronic
908786273 1:67737526-67737548 ATGCAGAAAGGGAAAGGGAAGGG - Intronic
908828496 1:68156411-68156433 ATGTAGGAAGGGGCTAGGAAGGG + Intronic
909406127 1:75291641-75291663 ATGGACAAAGGGCCTGTGAGGGG + Intronic
909418453 1:75434397-75434419 ATGAAAAAATGGGTTGGGAACGG - Intronic
909630458 1:77764909-77764931 ATGCATATAGGGGCTGGGTATGG - Intergenic
909892800 1:81028937-81028959 ATGGTTAGAGGGTCTGGGAAGGG - Intergenic
910260549 1:85289611-85289633 ATGGAGGATGGGGCAAGGAATGG - Intergenic
910505975 1:87950610-87950632 AGAAAGAAAGGGGCTGGGGAGGG + Intergenic
911068338 1:93812253-93812275 CTGGGGAAAGGGGATGGTAAGGG - Intronic
911151121 1:94597629-94597651 GTGGAGAAAGGGGCTGGAAGAGG + Intergenic
911182436 1:94873160-94873182 AGGCAGAAAAGGGCTGTGAAAGG - Intronic
911620903 1:100065664-100065686 AAGGGGAAAGGGGAAGGGAAAGG - Intronic
911749670 1:101481893-101481915 ATGGGGAAAGTGTGTGGGAAGGG + Intergenic
912185246 1:107267593-107267615 CTGGAGAGAGGTACTGGGAATGG - Intronic
912476919 1:109944264-109944286 ATGGAGAAAGGAGCAGCGATTGG + Intergenic
912520641 1:110242414-110242436 ATAGAAAAAGAGGCTGGCAAGGG + Intronic
912577389 1:110685960-110685982 ATGGAGAGAGGGACAGAGAATGG - Intergenic
912679476 1:111720088-111720110 ATGGAGGGAGGGGCAGGGCAGGG - Intronic
913085164 1:115430107-115430129 ATGGAGAAAGAGAATGGGAGGGG - Intergenic
913097192 1:115529603-115529625 GTGAAGGAAGGGGATGGGAAGGG + Intergenic
913246916 1:116878423-116878445 ATTGAGAGGGGTGCTGGGAAAGG - Intergenic
913480827 1:119287656-119287678 ATGGGAAATGGAGCTGGGAAAGG + Intergenic
913978117 1:143481720-143481742 CTGGAGAAAGGCACTGGGAAAGG - Intergenic
914072521 1:144307349-144307371 CTGGAGAAAGGCACTGGGAAAGG - Intergenic
914106633 1:144659007-144659029 CTGGAGAAAGGCACTGGGAAAGG + Intergenic
914243307 1:145867228-145867250 TGGGAGAAAGGGCTTGGGAAAGG - Intronic
914430118 1:147613082-147613104 CTGAAGAATGGGGCTGGAAATGG + Exonic
914765714 1:150636060-150636082 AAGGATAAATGGGCTGGGCACGG - Intergenic
914885727 1:151582853-151582875 ATGGAGCAAGGGGTTCAGAAGGG - Exonic
914901194 1:151712048-151712070 ACGAAGAAGGAGGCTGGGAAGGG - Intronic
914988742 1:152480520-152480542 ATGGAGAGAGAGACTGGGAAAGG - Intergenic
915002538 1:152606639-152606661 AGTGAGAAAGGCACTGGGAAGGG - Intergenic
915322995 1:155066263-155066285 GTGGAAACAGGGGTTGGGAAAGG - Intronic
915338820 1:155165150-155165172 ATGGGCAAAGGGGCTGGGCTTGG - Intergenic
915356009 1:155255463-155255485 CTAGAGAAGGGGGATGGGAATGG + Intronic
915384117 1:155473788-155473810 ATAAATAAAGAGGCTGGGAATGG - Intronic
915614755 1:157028874-157028896 ATGGAGAAACTGGCTGGGCGTGG + Intronic
915962908 1:160282127-160282149 ATGGACGAAGGGGATGGGGAAGG - Exonic
917213224 1:172651576-172651598 ATGGAGGTAGTGGCTGGGAATGG + Intergenic
917327518 1:173848141-173848163 ATGAAGAAAAGGGCCGGGCACGG - Intronic
917660604 1:177173540-177173562 GAGGAGAAAAGGGCTGGGGAAGG + Intronic
917818990 1:178741845-178741867 AAGCAGAAATGGGCTGGGCATGG + Intronic
917954905 1:180085116-180085138 AAGGGGAAAGGGGAAGGGAAAGG - Intronic
918132269 1:181639881-181639903 AAAGAGAAGGGGGTTGGGAATGG + Intronic
918141867 1:181726585-181726607 ATAGAGAAAGGGCCAGGGAGGGG + Intronic
918237160 1:182591867-182591889 ATGGGGGCAGGGGCTGGGCATGG - Intergenic
918335848 1:183511980-183512002 CTAGAGATAGGGGATGGGAATGG + Intronic
918422832 1:184381418-184381440 ATAGAAAAAGGAGCTGGGTATGG + Intergenic
918658671 1:187062047-187062069 ATGGAGATAGAGACAGGGAAAGG - Intergenic
919691476 1:200532015-200532037 ATGGGGGAAGAGACTGGGAAGGG + Intergenic
919699262 1:200614465-200614487 TTGGGGAAATAGGCTGGGAAGGG + Intronic
919908122 1:202092327-202092349 AGGGGCAAAGGGGCTGGAAAGGG - Intergenic
920006302 1:202836008-202836030 ATGGAGAGAGGGGAAGGGAGTGG - Intergenic
920760548 1:208779973-208779995 AAGGAGACAGTGGCTGGGCATGG - Intergenic
920871859 1:209801475-209801497 ATGGGAAAGGTGGCTGGGAAGGG - Intronic
921301491 1:213755357-213755379 ATGGAGAAGGAAGCAGGGAAAGG + Intergenic
921562724 1:216677584-216677606 ATAGAGAAAGGGAAAGGGAAAGG + Intronic
921627798 1:217397423-217397445 ATAGAGATAGGGTCTGAGAAGGG - Intergenic
922014939 1:221635750-221635772 AAGGAGAAAGGTGTTGGGGAAGG + Intergenic
922477993 1:225920161-225920183 GTGGAGACTGGGGCTGGGACTGG - Exonic
922809352 1:228407133-228407155 ATGGAGCAGGGGGCAGGGCAAGG + Intergenic
923205547 1:231755329-231755351 AAAGAGAAAGGGGCTGGGCATGG - Intronic
923211927 1:231811263-231811285 AGGGAGAAGGGGGTTGGGGAGGG + Intronic
923215010 1:231840622-231840644 ATTGGGAGAGGGGCTGGGGAAGG + Intronic
923570622 1:235110313-235110335 AGGGAGAACAGGGGTGGGAAAGG - Exonic
923600181 1:235395833-235395855 AAGTAGAACGGGGCTGGGCACGG - Intronic
924191797 1:241561206-241561228 ATGAAGAAAGAGGCTTGGACTGG - Intronic
924196803 1:241616158-241616180 ATAGAGGAAGAGGCAGGGAAAGG - Intronic
924263034 1:242251618-242251640 ATGGAGAAAAGGGCAGGCATTGG + Intronic
924421819 1:243917080-243917102 AAGGAGAGAAGGGCGGGGAAGGG + Intergenic
924946955 1:248853010-248853032 AGGGAGAAATGGGCTTGGGAAGG - Intronic
1063194574 10:3729512-3729534 AAGGAGAAAAGGGCTCAGAATGG - Intergenic
1063238663 10:4145678-4145700 ATAGAGAATGGGGCCGGGCACGG - Intergenic
1063303876 10:4878587-4878609 ATGGGGAAAGGGATTTGGAAAGG + Intergenic
1064624417 10:17247695-17247717 GTGGAGAAAGGGCCTGGAAAAGG - Intergenic
1064753715 10:18556642-18556664 ATGGAGAATGGAGTGGGGAATGG + Intronic
1064754187 10:18559828-18559850 ATGGAGAAAGGAATGGGGAATGG + Intronic
1064754918 10:18565019-18565041 ATGGAGAATGGAGTGGGGAATGG - Intronic
1064755876 10:18571518-18571540 ATGGAGAATGGAGTGGGGAATGG - Intronic
1064779284 10:18816686-18816708 ATGTAGAAAGTGGCTGGAGATGG + Intergenic
1065204378 10:23343814-23343836 CTGGAGCAAGGGGCCTGGAAAGG + Intronic
1065311144 10:24416919-24416941 ATGGAGGAGGAGTCTGGGAAGGG - Intronic
1065580375 10:27164926-27164948 AAGGAGACAGTGGCTGGGCACGG - Intronic
1065732946 10:28725830-28725852 GGAGTGAAAGGGGCTGGGAAAGG - Intergenic
1065784030 10:29196441-29196463 TTGGAGAAAGTGGCTGAGAAGGG - Intergenic
1065979520 10:30878433-30878455 GTGGAGAGAGGAGCTGGAAAGGG - Intronic
1066011202 10:31195202-31195224 CAGGAGACAGGAGCTGGGAAAGG - Intergenic
1066192226 10:33066582-33066604 ATGTAGAAAGTGGCTGGGTGTGG - Intergenic
1066314667 10:34232639-34232661 ATAGAGAAAGTAACTGGGAAGGG + Intronic
1066613870 10:37277255-37277277 ATGCATAAAGGGGCTTGGAAAGG + Intronic
1066721751 10:38346831-38346853 ATGGAGAAAAGGGCAGGAATTGG - Intergenic
1067009002 10:42691959-42691981 AGGGGGGAAGGGGCTGGGCATGG + Intergenic
1067455334 10:46415073-46415095 AGGGAGAAAGTGGCTGGCCAAGG + Intergenic
1067631870 10:47969562-47969584 AGGGAGAAAGTGGCTGGCCAAGG - Intergenic
1067902350 10:50255326-50255348 AGGGAGAAATGGCCAGGGAAAGG + Intergenic
1068874304 10:61980189-61980211 ATGGAGGAAGGGGCTCAGGAGGG + Intronic
1069427846 10:68305401-68305423 ATGGAGAACTGGGCTGGGTGTGG - Intronic
1069627053 10:69874816-69874838 AGGGAGCAAGGGCCTTGGAAAGG + Intronic
1069788915 10:71006916-71006938 ATGGAGGGAGGGGCTCGGTAGGG + Intergenic
1069935688 10:71914355-71914377 ATGCACAAAGGGGCTGGGCATGG - Intergenic
1069972901 10:72188526-72188548 AAGGAGAAAGGGAAAGGGAAGGG + Intronic
1070055219 10:72927875-72927897 ATGGAGAAAGGTGCCAGGAAAGG - Intronic
1070368641 10:75760590-75760612 ATGGGGACAGGGGCAGGGGAGGG - Intronic
1071335431 10:84596587-84596609 TTCTAGAAAGGGGCTGGGCACGG - Intergenic
1071712311 10:88061567-88061589 AACGAGAAAGGGGCCGGGCATGG - Intergenic
1072048351 10:91679451-91679473 ATGCGGAAAGGGGCAAGGAACGG - Intergenic
1072145883 10:92636740-92636762 ATGGAGAATGGGGCCGGGCGCGG + Intronic
1072161643 10:92772184-92772206 ATGGGAAAAGGGCCTGGGGAGGG + Intergenic
1072214018 10:93272945-93272967 ATGGAGATAGTGACAGGGAAGGG + Intergenic
1072252310 10:93591299-93591321 ATGCAGGGAGGGGCTGGGTAGGG - Intronic
1072268707 10:93754932-93754954 CTGGGGAGAGGGGCTTGGAAAGG - Intergenic
1072735940 10:97879840-97879862 AAAGAGAAAGGGGGTGGGGACGG + Intronic
1073030805 10:100524151-100524173 AAGGAGAAAGGGGGAGGGAAGGG + Intronic
1073200440 10:101730973-101730995 AAGGGCAAAGGGGCTGGGCATGG - Intergenic
1073345056 10:102776706-102776728 CTGAAGAATGGGGCTGGGGAAGG + Intronic
1073506461 10:103997002-103997024 ATGGAGATAGGTGATGGTAATGG - Intronic
1073607710 10:104913061-104913083 GAGGAGCAAGTGGCTGGGAATGG + Intronic
1073647820 10:105324353-105324375 ATATATAGAGGGGCTGGGAAAGG - Intergenic
1073737493 10:106366496-106366518 GTGGAGAAAGGGGCAGGGGCAGG - Intergenic
1073877339 10:107940431-107940453 ATGGGGAAGGGGGCCGGGCACGG + Intergenic
1074009224 10:109459346-109459368 ATGGATAAAGAGGCTGGGTGTGG - Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074311435 10:112326422-112326444 AAGGACAAGGGGGATGGGAATGG - Intergenic
1074969760 10:118526462-118526484 AAGGAGAAAGGGGCTGAAATGGG + Intergenic
1075453095 10:122567149-122567171 ATCCAGAAATGGCCTGGGAAAGG + Intronic
1075568970 10:123525210-123525232 AAGGATAAAGAGGCTGGGCACGG - Intergenic
1075642647 10:124075848-124075870 CTGGAGCAAGAGGCTTGGAAGGG - Intronic
1075759159 10:124842244-124842266 ATGTATAAAGAGGCTGGGCACGG + Intergenic
1075857769 10:125644947-125644969 ATGTAGCAAGGAGCTGAGAAGGG + Intronic
1075926723 10:126257079-126257101 AGGGAGGAAGGGGCTGAGAGTGG - Intronic
1076317217 10:129551034-129551056 ATAGGGAACGGGGCTGGGACAGG - Intronic
1076543319 10:131228015-131228037 ACGGAGAGGGGGGCTGGGCAAGG - Intronic
1076666826 10:132097942-132097964 AAAGGGAAAGGGGATGGGAAAGG - Intergenic
1076838409 10:133032717-133032739 AGGGAGAAGGGGGCAGGGAGAGG - Intergenic
1077345094 11:2044036-2044058 ATGGATAAAGGAGCTGGGCATGG - Intergenic
1077374074 11:2197459-2197481 AGGAGGAGAGGGGCTGGGAAGGG + Intergenic
1077490503 11:2858806-2858828 ATGGAGAAGGTGGCCTGGAAAGG + Intergenic
1077592639 11:3504591-3504613 ATGAATAATGGGGCTGGGCATGG - Intergenic
1077652189 11:3983222-3983244 ATGGAGATAGAGGCAGGGCATGG - Intronic
1077652316 11:3984154-3984176 AAGGAGAAAGAGGCTGGACACGG - Intronic
1078322920 11:10352874-10352896 TTAGAAAATGGGGCTGGGAATGG - Intronic
1078670648 11:13362047-13362069 AGAGAGAAGGGGCCTGGGAATGG + Intronic
1078877424 11:15412417-15412439 GTGGAGAAAGGATCTGGGGAAGG + Intergenic
1079014561 11:16857519-16857541 CTGGAGAAAGGGGATGGACAAGG - Intronic
1079422159 11:20303731-20303753 GTTGAGACAGGGACTGGGAATGG + Intergenic
1079455055 11:20629235-20629257 AAGGACAAAGGGGCAGGGGAGGG - Intronic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1079670225 11:23159818-23159840 ATGGAGACCAGGGCTGGGAGTGG + Intergenic
1079932104 11:26577271-26577293 AGAGAGAAAGTGGCTGGGCATGG + Intronic
1080241580 11:30133315-30133337 GTGGAGAAAGCGTCTGGGAAGGG - Intergenic
1081034393 11:38124146-38124168 AGTTAGAAAGGGGATGGGAAGGG + Intergenic
1081362155 11:42193334-42193356 ATGGAGGCAGGGGGTTGGAATGG + Intergenic
1081982581 11:47277585-47277607 ATGTAGAAAGAGGCTGGGCACGG - Intronic
1081993621 11:47350482-47350504 AAGGTGAGAGGGGCTGGGCAGGG - Exonic
1082013480 11:47467095-47467117 ATGTAGCTAGGGGCTGGGGAGGG - Intronic
1083179837 11:60978210-60978232 AAGGACAAAGGGGGTGGGCATGG + Intronic
1083199844 11:61113958-61113980 ATCCAGAAAGGGGCCGGGCACGG - Intronic
1083251245 11:61468826-61468848 ATGGACAATGTGGCTGGGCATGG + Intronic
1083575639 11:63789098-63789120 AAGAAGAAAGAGGCTGGGCACGG + Intergenic
1083726541 11:64631301-64631323 GTGGAGCTAGGGGCTGGGGAAGG + Intronic
1084068026 11:66716564-66716586 ATGCAGGGAGGGGCTGGGATGGG + Intronic
1084179247 11:67438374-67438396 ATGGAGAACGGGGATGCGTAGGG - Exonic
1084187833 11:67484208-67484230 TTGGAAGAAGGGGCTGGCAAGGG + Intronic
1084248471 11:67877311-67877333 ATGGATAATGGGGCCGGGCATGG - Intergenic
1084669795 11:70598282-70598304 ATAGAGGAAGAGGCTGGAAATGG + Intronic
1085428609 11:76426747-76426769 AGGGAGAGAGGGGAAGGGAAGGG + Intergenic
1085555222 11:77413243-77413265 GTGGAGAAAGGGGGTAGGAGTGG + Intronic
1085879402 11:80448208-80448230 AGGGAGAAGGGGAATGGGAAAGG - Intergenic
1086074244 11:82833362-82833384 ATGGAAAAAGAGGATGAGAAAGG + Intronic
1086165445 11:83772486-83772508 AAGGAGAAGGGGGAGGGGAAGGG + Intronic
1086243243 11:84720947-84720969 TGGGAGGAAGGGGCTGAGAAAGG + Intronic
1086276339 11:85133998-85134020 AAGGAGAGAGGGGGTGGGAAGGG + Intronic
1086457072 11:86969525-86969547 AAGGAGAAAGGGGATGGCAGAGG - Intergenic
1086892456 11:92273355-92273377 ATCTAGAAAGGGGCAGGGATAGG - Intergenic
1086920946 11:92585958-92585980 AGGGAGAAGGTGGCTGGGTAGGG + Intronic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1087277135 11:96171843-96171865 ATGGAGAAGGTGGCAGGCAAGGG - Intronic
1087602977 11:100339352-100339374 GTGGAGAAGGGAGCTGGAAAGGG + Intronic
1087931872 11:103987286-103987308 AAAGAGAAATGGGGTGGGAAAGG - Intronic
1088242153 11:107783888-107783910 ATGAAGAAAGGGGCCGGGCACGG + Intergenic
1088480590 11:110293266-110293288 ATGGAAAACAGGACTGGGAAAGG + Intronic
1088488696 11:110366181-110366203 ATGGAAACAGGGGCCGGGCACGG - Intergenic
1088626107 11:111731871-111731893 ATGGAGAAATCTGGTGGGAAAGG - Intronic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1089061461 11:115629499-115629521 ATGGAGAAATTGGGTGGGAAGGG - Intergenic
1089204084 11:116744458-116744480 ATGGAGAATGAAGCGGGGAAAGG - Intergenic
1089560427 11:119340657-119340679 GAGGGGAAAGGGGCTGGGGAGGG - Intronic
1089589761 11:119532890-119532912 ATGGAGGCAGGGGGTGGGAGTGG - Intergenic
1089624761 11:119744290-119744312 AAGAAGAAAGGGGATGGGAGGGG - Intergenic
1089773732 11:120821437-120821459 ATGGAAAGAGAGGCTGGGGAAGG + Intronic
1089791378 11:120947111-120947133 AGGGAGAAATAGGCTGGGCACGG + Intronic
1089809167 11:121117558-121117580 ATGAGGAAAGGGGAGGGGAATGG - Intronic
1089834459 11:121357726-121357748 ACTGTGAAAGGGCCTGGGAAAGG + Intergenic
1090582457 11:128175018-128175040 ATGGAAAAAGGGTTTGGGAAAGG - Intergenic
1090606954 11:128431730-128431752 AAGGAAACAGGGGCTGGGAGAGG - Intergenic
1090621671 11:128566249-128566271 GTGGATACTGGGGCTGGGAAGGG - Intronic
1090622460 11:128573027-128573049 GTGGGCAAAGGGGCAGGGAAGGG + Intronic
1090936214 11:131344879-131344901 ATTGAAGAAGGGGCGGGGAAAGG - Intergenic
1090961681 11:131562871-131562893 ATGGTTAAAGGGGCAGGAAATGG - Intronic
1091101732 11:132880935-132880957 AAGAGGCAAGGGGCTGGGAATGG - Intronic
1091136947 11:133200089-133200111 ATGGAGATAGGAGCTGTGTAGGG - Intronic
1091338407 11:134791794-134791816 AGGGAGAAATGGGCTGCAAAGGG + Intergenic
1202828023 11_KI270721v1_random:98908-98930 ATGGATAAAGGAGCTGGGCATGG - Intergenic
1091642111 12:2245288-2245310 ATGGAGAATGGAGCTGAGAATGG - Intronic
1091661175 12:2384941-2384963 ATCTGGAAAGGGGCTGGGAGTGG + Intronic
1091668908 12:2438521-2438543 GTGGAGAAAGTGGCAGGGATGGG + Intronic
1091755815 12:3050743-3050765 AGCAAGAAAGGGGCTGGGCATGG - Intergenic
1091909703 12:4219599-4219621 CTGGAGGTAGGGGCTGGGCATGG - Intergenic
1092029981 12:5275939-5275961 ATGCAGAAGGGGTTTGGGAAAGG - Intergenic
1092050828 12:5468828-5468850 ACAGAGAAAGCGGCTGGGCATGG + Intronic
1092141001 12:6183275-6183297 ATGGACAAAGGTTATGGGAAGGG + Intergenic
1092171885 12:6378708-6378730 AAGGAGAACTGGGCTTGGAAAGG - Intronic
1092367658 12:7890427-7890449 ATGGAGGATGGGGTCGGGAAGGG - Intronic
1093096083 12:14973731-14973753 AGGCAGGAAGGAGCTGGGAAGGG - Intronic
1093706450 12:22279780-22279802 ATGGGGAAAGGGGTTGGCTAGGG - Intronic
1094036661 12:26079292-26079314 ATGGTCAAAGGGGCTGGGCATGG + Intronic
1094558309 12:31524899-31524921 ATGAAGAAAGGGGAATGGAAGGG - Intronic
1095938842 12:47712671-47712693 GTGGAGAAAGGGGATTGGAGGGG - Intronic
1096193945 12:49636911-49636933 ATCCAGAAGGGGGCAGGGAATGG - Exonic
1096294109 12:50369198-50369220 ATAGATAAATGGGCTGGGCACGG + Intronic
1096503270 12:52078412-52078434 AGGGAGAAATGGGGTGGGAGTGG + Intergenic
1096629774 12:52918772-52918794 GTGGAGAAAGGCTTTGGGAAAGG - Intronic
1096774596 12:53956239-53956261 AAGGTGAAAGGGTCTGGGGAAGG + Intronic
1097133265 12:56829867-56829889 TTGGGCAAAGGGGCTGGGCATGG + Intergenic
1097154899 12:57005869-57005891 ATGGAGAAAGGGGCTGTGTTGGG - Intronic
1098609003 12:72432085-72432107 AAGGAGAAAGGGGGTAAGAAAGG - Intronic
1098688814 12:73460682-73460704 AGGGAGAAAGGGGTTAGAAAAGG - Intergenic
1101157745 12:101943792-101943814 CTGGAGAAAGGGGCAGGGCCTGG + Intronic
1101210857 12:102534145-102534167 ATGGTGTAAGGGGCTGGTTAAGG - Intergenic
1101381390 12:104216387-104216409 ATGGAGAAAGGGGGCCGGGAAGG - Intronic
1101685912 12:107020619-107020641 ATGGTGGAAGGGGAAGGGAAAGG - Intronic
1101918454 12:108913939-108913961 ATGAAGAAATGGGCTGGGCATGG - Intronic
1101966971 12:109288122-109288144 ATGGAGAAGGGGACTTGGAGTGG + Exonic
1102477324 12:113196934-113196956 ATGCAGAAACGGGCTTGGGAAGG + Intronic
1102500309 12:113347568-113347590 AAGGAGAAAGGGGCTGGTCATGG + Intronic
1102598823 12:114013126-114013148 ATGGAGAGAGGGGAGGGGGATGG + Intergenic
1103293678 12:119867887-119867909 ATGGAGGAAGGGGCTGAGGAAGG - Intronic
1103656817 12:122477492-122477514 ATGAAGACAGGGGCCGGGCACGG + Intronic
1103793818 12:123490031-123490053 AAGGAGAAAGGGGATGGAAAAGG - Intronic
1103825090 12:123731668-123731690 CAGGAAAAAGAGGCTGGGAATGG - Intronic
1104163969 12:126208040-126208062 ATGGAAACAGGTGCTGGGTAGGG - Intergenic
1104359075 12:128115133-128115155 ATGAAGAAATGGGCTGGGTGTGG - Intergenic
1104854091 12:131894253-131894275 AGGGAGAGAGGTGATGGGAAGGG + Intergenic
1105221237 13:18329740-18329762 TTGGAGAAAGGCACTGGGAAAGG + Intergenic
1105494128 13:20915611-20915633 ATGGACAAAGGGGCTGAGCACGG + Intergenic
1105533984 13:21246909-21246931 ATGCAGAATGGAGCTGGGGATGG + Intergenic
1105891511 13:24685617-24685639 AAGGAGAAAGTGGCCGGGTAGGG + Intronic
1105938006 13:25119693-25119715 ATATAGAAAGGTCCTGGGAAAGG - Intergenic
1106200239 13:27530266-27530288 CTGGAGAAAGGGGTGGGGAGTGG - Intergenic
1106542917 13:30705864-30705886 CTGGAGGAGAGGGCTGGGAAGGG + Intergenic
1106666424 13:31856051-31856073 ATGAAAATAGGGGCTGGGTATGG + Intergenic
1106674262 13:31941185-31941207 ATGGAGAGAGGGGATGGGAAAGG - Intergenic
1106684871 13:32047995-32048017 ATGTAGAAAGGGTAGGGGAAGGG - Intronic
1106704311 13:32264620-32264642 ATGGAAAAAGAGGCTGGGTTTGG - Intronic
1108207107 13:48101458-48101480 ATTGAGAAAGAGGAAGGGAAAGG - Intergenic
1108379537 13:49842890-49842912 ATGATGATAGGGGCTGTGAAAGG + Intergenic
1108393899 13:49974432-49974454 ATGGAGAAACAGGCCGGGTACGG - Intergenic
1108419893 13:50237945-50237967 ATGTAGAAAGGGGATGGGGAAGG + Intronic
1109447772 13:62466709-62466731 ATGAAGAAATCGGCTGGGTAAGG + Intergenic
1109509138 13:63346380-63346402 AGGAAAAAAGGGGCTGGGTACGG + Intergenic
1110212705 13:72992006-72992028 ATTGAGACGGGGGCTGGGCACGG - Intronic
1110561655 13:76916447-76916469 ACAGAGAAATGGGCTGGGAGTGG - Intergenic
1111741931 13:92215953-92215975 ATGGTGAGAGGGTCTGGGAATGG + Intronic
1112295101 13:98179526-98179548 CTGTAGAAGTGGGCTGGGAAGGG + Intronic
1112982620 13:105404538-105404560 ATGGAGAGAGGGACAGGGGAAGG + Intergenic
1113303868 13:109054949-109054971 AGGGAGGAAGGGGAAGGGAAGGG - Intronic
1113654411 13:112058808-112058830 AGAGAGAAAGGGGTTGGGGAAGG + Intergenic
1113741374 13:112714451-112714473 AGGGAGAAAGGGAAGGGGAAGGG - Intronic
1114242726 14:20883353-20883375 AAAGAGAGAGGGGCTGGGCATGG - Intergenic
1114249657 14:20947285-20947307 AAAGAGAGAGGGGCTGGGCATGG - Intergenic
1115194201 14:30778399-30778421 AGGGATAAAGGGGCCGGGAGCGG - Intergenic
1115359966 14:32489497-32489519 CAAGAGAAAGGGGCTGGGCATGG - Intronic
1116838264 14:49792500-49792522 ATGGAGATTGTGGCTGGGCACGG - Intronic
1116993278 14:51297670-51297692 TGTGAGAAAGGGGCTGGAAAAGG + Intergenic
1117220451 14:53599404-53599426 AGGGAGGATGGGGCTGGGTAAGG - Intergenic
1117878364 14:60280332-60280354 ATGGAGAAAGAGATTCGGAAAGG + Intronic
1118342400 14:64905752-64905774 TTGGAGTAAGGTGGTGGGAAGGG + Intergenic
1118528647 14:66675432-66675454 CTGGAAAAAGGGGCCGGGAGCGG - Intronic
1118645011 14:67829987-67830009 ATAGGCAAAGGAGCTGGGAAGGG + Intronic
1118809450 14:69262198-69262220 GCGGAGAAAGAGGCTGGGCAGGG + Intronic
1118850297 14:69577914-69577936 ATGTAGAAATTGGCTGGGCACGG + Intergenic
1119094805 14:71819535-71819557 AAGAAGAAAGAGGGTGGGAATGG - Intergenic
1119168064 14:72512465-72512487 ATGGGGAAAGGAGCTGGCAGAGG - Intronic
1119185215 14:72636480-72636502 ATGAAGAGAGGGGGAGGGAATGG - Intronic
1119220285 14:72900960-72900982 AGGGAGAAGGGGGCTGGGGCTGG - Intergenic
1119349669 14:73953685-73953707 GTGGAGAGAGGGGGTGGGATTGG + Intronic
1119530851 14:75360146-75360168 ATGGCTGAAGGGGCTGGGCATGG - Intergenic
1119558826 14:75573804-75573826 AAGGAGAATGGGGCCGGGCACGG - Intergenic
1119619486 14:76121205-76121227 AGGGAGAAATGGGCTAGGAATGG - Intergenic
1119621704 14:76136542-76136564 CTGGGGAGAGGGGCTGAGAAGGG + Intergenic
1119808566 14:77498516-77498538 ATGGAGAGAGGGGCCGGGGCCGG - Intronic
1120279285 14:82419423-82419445 GGGGAGAAAGGGGAAGGGAAAGG - Intergenic
1121097360 14:91226967-91226989 ATTGAGAAGGAGGCTGGGCATGG + Intergenic
1121144712 14:91573990-91574012 AGAGAGAAAGAGGCTGGGCAGGG + Intergenic
1121418387 14:93795110-93795132 ATCTAGAATGGGGCTGGGCATGG + Intergenic
1121975628 14:98401391-98401413 AAAGAGAAAGGTGCAGGGAAGGG + Intergenic
1122014984 14:98787665-98787687 ATGGAGAGTGGGGCTGGGCATGG - Intergenic
1122737363 14:103850546-103850568 ATGATTAAAGGGGCTGGGCACGG + Intergenic
1122764424 14:104055528-104055550 ATGAAGAAAGGAGCTCCGAAAGG - Intergenic
1122846487 14:104502889-104502911 ATGGAGTAATGGGCTGTGATGGG - Intronic
1122954563 14:105064622-105064644 ATGAGGATAGGGGCTGGGCACGG - Intronic
1123431906 15:20225178-20225200 TTGAAGAAAGGGAATGGGAAAGG - Intergenic
1123828935 15:24113698-24113720 ATGAAGAATGAGGCTGGGCATGG + Intergenic
1124042153 15:26115641-26115663 ATGGAGAAAAGTGCTGGGAAAGG - Intergenic
1124472925 15:30004142-30004164 ATAGATACAGGGGCTGGGCATGG + Intergenic
1125397916 15:39270180-39270202 AAAGAAGAAGGGGCTGGGAAGGG - Intergenic
1125614205 15:40995246-40995268 ATAAAGGGAGGGGCTGGGAAAGG + Intronic
1125627750 15:41122529-41122551 AGGGAGGGAGGGGCAGGGAAGGG + Intergenic
1126108166 15:45160663-45160685 ATGGAGGATGGAGTTGGGAATGG + Intronic
1127279831 15:57479371-57479393 ATGGGCAAAGGGGCTGGGCATGG + Intronic
1127421919 15:58814659-58814681 ATGGGGAAAAGGGCTGGACATGG - Intronic
1127517810 15:59713380-59713402 AGGAAGAAAGGGGAAGGGAAGGG - Intergenic
1127579984 15:60329420-60329442 GTGGAGGAAGGGGCTGTGATTGG - Intergenic
1127693717 15:61423109-61423131 AGGGAGGAAGAGGCTGGCAAGGG + Intergenic
1127732840 15:61816192-61816214 ACGGAGCACAGGGCTGGGAAGGG + Intergenic
1128003393 15:64215500-64215522 TAGTAGAAAAGGGCTGGGAATGG - Intronic
1128084103 15:64874103-64874125 AGGGAGAAAGGGGCCGGGCACGG - Intronic
1128320498 15:66690450-66690472 GTGGAGAAAGGGGGTGGAAATGG - Intergenic
1128409603 15:67381222-67381244 ATGCAGAAAGGGACTGGGAAAGG + Intronic
1128465133 15:67904241-67904263 ATGCAGAAATTGGCTGGGCATGG - Intergenic
1128474365 15:67984501-67984523 TTGGACAAAGGGGCTTGGAGGGG - Intergenic
1128531196 15:68449293-68449315 ATAGACAAAGGGGCTAGCAATGG - Intergenic
1128699932 15:69796751-69796773 GGGTAGAAAGGGGCTGAGAATGG + Intergenic
1128724449 15:69977652-69977674 ATGGAGAAAGGAGCTGAGGTTGG + Intergenic
1128769467 15:70271059-70271081 ATGGTGAAATGGCCTGTGAAAGG + Intergenic
1128870406 15:71151054-71151076 ATGGAGAAAAGGGCTGGGCTGGG + Intronic
1128884264 15:71272110-71272132 ATGGGCAAAGGGGCTGGGTGTGG + Intronic
1129053167 15:72799164-72799186 AGGGAGAAAGGGCAAGGGAAGGG - Intergenic
1129107368 15:73319199-73319221 CTGGAGACAGGGGTGGGGAAGGG + Intergenic
1129164286 15:73767508-73767530 ATGGAGGAAGCGGGTGTGAAGGG + Intergenic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129233223 15:74208359-74208381 AGGGAGGAACGTGCTGGGAACGG - Intronic
1129317062 15:74751364-74751386 ATGGACTGAGGGGCTGGGCAAGG - Intronic
1129648316 15:77459497-77459519 GTGGAGAAAAGGGATAGGAAGGG + Intronic
1129661997 15:77558091-77558113 GTGGACAGAGGGGCTGTGAATGG + Intergenic
1129675889 15:77632391-77632413 ACGGAGGAGGGGGCTGGGCAGGG - Exonic
1130567394 15:85008417-85008439 ATGGAGGAAGGGTCTGGTGAGGG - Intronic
1130653702 15:85777137-85777159 ATGGAGCAAGGATCAGGGAAGGG + Intronic
1130966163 15:88699533-88699555 ACAGAGGAAGGGGTTGGGAATGG - Intergenic
1130983664 15:88830286-88830308 ATAAAGAAACGGGCTGGGGAAGG - Intronic
1131059726 15:89397299-89397321 ATGGGGAACAGGGCTGTGAATGG + Intergenic
1131108424 15:89749967-89749989 ATGGAGGGAGGGGCTGAGAAGGG + Exonic
1131252110 15:90837720-90837742 AGAGAGAAGGGGGCTGAGAAGGG - Intergenic
1131439526 15:92448402-92448424 GTGGAGGAATGGGCTGGGGAGGG + Intronic
1131721931 15:95178926-95178948 ATATAGAAAGAGGCTGGGCATGG - Intergenic
1132590750 16:725376-725398 ATGGAGAGCCTGGCTGGGAAAGG - Intronic
1133187222 16:4108660-4108682 ATGGAGAAATGGGCCGGGCGTGG - Intronic
1133444225 16:5846357-5846379 ATGGGGAAAGGTGTAGGGAAAGG + Intergenic
1133592933 16:7263605-7263627 AGGTAGAAAGAGGCTGGGAACGG + Intronic
1133714446 16:8433391-8433413 ATGGAGAAAGGGGTGGTGATTGG + Intergenic
1133874711 16:9722982-9723004 TTGGAGAAAGAGGATGGGAGGGG - Intergenic
1134398659 16:13889072-13889094 AAGGAGAAAGGGGAGGGGGAGGG - Intergenic
1134718956 16:16370584-16370606 ATGGAGAAAGGGGAGGGAAGGGG - Intergenic
1134788790 16:16969667-16969689 ATAGAAAAAGGAGCTGGGCACGG + Intergenic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135010547 16:18873860-18873882 AAGGAGAAAGTGGGTGGGGATGG - Intronic
1135198818 16:20419136-20419158 AGGCAGGAAGGGGCTGGGGAGGG - Intronic
1135219863 16:20604539-20604561 AGGCAGGAAGGGGCTGGGGAGGG + Intergenic
1135317421 16:21461445-21461467 AAGGAGAAAGTGGGTGGGGATGG - Intergenic
1135370319 16:21893257-21893279 AAGGAGAAAGTGGGTGGGGATGG - Intergenic
1135441470 16:22477444-22477466 AAGGAGAAAGTGGGTGGGGATGG + Intergenic
1135711995 16:24725536-24725558 ATGGAGAGAGGAGCTGGGGAGGG - Intergenic
1135739116 16:24958115-24958137 ATGGAGAGCGGGGATGGGACAGG - Intronic
1135861259 16:26058212-26058234 TTGGAGAAAGGGGCTGAGCCAGG + Intronic
1136249331 16:28993592-28993614 ATGGTGGGAGGGTCTGGGAAGGG + Intergenic
1136292031 16:29279872-29279894 ATGGACAAAAGGGCTGGGCGCGG - Intergenic
1136520400 16:30792032-30792054 TTGGAGAGAGGAGCTGGGAAGGG + Intergenic
1137055121 16:35741930-35741952 ATGGAAAGAGGAGTTGGGAAAGG + Intergenic
1137389753 16:48071504-48071526 AAGAGCAAAGGGGCTGGGAATGG + Intergenic
1137632957 16:49960333-49960355 AAAGAGCCAGGGGCTGGGAATGG + Intergenic
1137778091 16:51073338-51073360 ATGGAGACAGGGGTAGGGGAGGG - Intergenic
1137822137 16:51456285-51456307 TTGGACAAAGGGACTGGGAGAGG + Intergenic
1138092886 16:54191012-54191034 GTGGAAAGAGGGGTTGGGAAAGG + Intergenic
1138110084 16:54316777-54316799 ATGGAGAGAGGTGCTGGGGATGG - Intergenic
1138475841 16:57270297-57270319 ATGGACTCAGGGGCTGGGGAAGG - Intronic
1138622691 16:58224464-58224486 ATGCAGAAAGTGGCTGGCAGAGG + Intergenic
1138945235 16:61841520-61841542 AGGTAGTAAGGGGCTGGGGAGGG + Intronic
1139137639 16:64223999-64224021 ATGGGGTAGGGTGCTGGGAAGGG + Intergenic
1139252449 16:65509082-65509104 AAGGAGAAAAGGGCCAGGAATGG - Intergenic
1139370014 16:66461183-66461205 AGGGAGACCGGGGGTGGGAAGGG + Intronic
1139387278 16:66580748-66580770 ATGAGGAAACAGGCTGGGAATGG - Intronic
1139495489 16:67314145-67314167 AGGGAGAGAGGGGCTGGGCACGG - Intronic
1139512700 16:67436417-67436439 GTGGGGAATGGGGCTGGGAATGG + Intronic
1139605169 16:68013110-68013132 AGGAAGAAAGAGGCTGGGTATGG + Intronic
1139623953 16:68170100-68170122 ATGCAAAATGGGGCTGGGCATGG + Intronic
1139727859 16:68916438-68916460 AGGGGGAGAGGGGCGGGGAATGG - Intronic
1139786776 16:69399399-69399421 ATCTAGAAAGGGGTTGGGATGGG - Intronic
1139889142 16:70236670-70236692 AAGGAGAAAGTGGGTGGGGATGG - Intergenic
1140350881 16:74261031-74261053 ATGGAGAGAGAGGCTGGGTCAGG - Intergenic
1140597713 16:76435930-76435952 CTGGAGAACAGGGATGGGAATGG - Intronic
1140731837 16:77863592-77863614 AGGAAGAAAGGGGCAGGGAGGGG + Intronic
1140989366 16:80193684-80193706 ATGAAGAAGGGGGCAGGGAGTGG - Intergenic
1141199415 16:81885514-81885536 ATGAAGAAAGGGGAAGGGTAGGG - Intronic
1141265800 16:82495823-82495845 ATGGAGAAAGGGTGGAGGAAGGG + Intergenic
1141276029 16:82589062-82589084 ATGAAAGAAGGGGCTGGGCACGG + Intergenic
1141404445 16:83779530-83779552 ACTGAGAAATGGGCTGGGCATGG + Intronic
1141475967 16:84273682-84273704 AAGGTGATTGGGGCTGGGAAGGG + Intergenic
1141569561 16:84925958-84925980 ATGGAGGAATGAGCTGGGAATGG + Intergenic
1141647808 16:85376792-85376814 ATGGAGGTGGGGGCTGTGAAGGG + Intergenic
1141804861 16:86335925-86335947 AGGGAGCAAGGGGCGGGGCAAGG - Intergenic
1141942492 16:87286903-87286925 AAGGAGGAAGGGGCAGGGGAGGG + Intronic
1141985523 16:87577293-87577315 TTGGAGAAAGAGGCTGGGCGTGG - Intergenic
1142097922 16:88253827-88253849 ATGGACAAAAGGGCTGGGCGCGG - Intergenic
1142304682 16:89278678-89278700 AGGGAGAAGGGGGCGGGGCAGGG + Intronic
1142495823 17:305820-305842 AGGAAGAAAGGGGCTGGGGAGGG - Intronic
1142523067 17:518611-518633 ATGGAGGAAGGGGCTGGGCTCGG + Exonic
1142783054 17:2196739-2196761 ATGAAGAAAGGGGCCGGGCATGG + Intronic
1142854062 17:2720258-2720280 ATGGAGAGAGGGGCAGGGCTTGG + Intergenic
1143097639 17:4486881-4486903 AAGGAGAAAGGGGCCGGGCGCGG + Intronic
1143119134 17:4596482-4596504 TGGGAGGAAGGAGCTGGGAAAGG + Intronic
1143254728 17:5547469-5547491 ATAAAGAAATGGGCTGGGGAAGG - Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143510249 17:7391557-7391579 GTGCAGGAAGGGGATGGGAATGG - Intronic
1143573522 17:7776173-7776195 AGGGAACAAGGGGCTGGGCACGG + Intronic
1143637481 17:8174433-8174455 ATGGAGGAAAGGGCTGGGTAGGG + Intronic
1143816490 17:9519800-9519822 ATGGACAAAGGGGGTGGGGGTGG - Intronic
1143888505 17:10084755-10084777 ATAGGGAAAGGGGCCGGGCACGG - Intronic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1143906031 17:10209843-10209865 GTGGACAAAGGGGCTGGCCAAGG + Intergenic
1143924844 17:10360478-10360500 ATGGAAAAGGGCGATGGGAAAGG - Intronic
1144025276 17:11271748-11271770 ATGGAAAATGGGGCTGGGCGTGG - Intronic
1144027202 17:11287720-11287742 AGGGAGGAAGGGGCTGGGAAGGG + Intronic
1144561008 17:16320288-16320310 AGGGAGGAAGGGGAAGGGAAGGG + Intronic
1144783089 17:17817504-17817526 AGAGAGCATGGGGCTGGGAAGGG + Intronic
1145084686 17:19927506-19927528 ATGGGCAAAGGGGCTGAGCAAGG + Intronic
1145247571 17:21279746-21279768 ATGGTGAGAGGGGCTGGGGCAGG + Intergenic
1145782668 17:27573282-27573304 TTGGGGAAAGGGGCAGGCAATGG - Intronic
1146229360 17:31094907-31094929 ATTGAGAGCGCGGCTGGGAAAGG - Exonic
1146297154 17:31659164-31659186 AGGGAGAAAGGGGGAGGGAGAGG + Intergenic
1146297164 17:31659190-31659212 AGGGAGAAAGGGGGAGGGAGAGG + Intergenic
1146297172 17:31659210-31659232 AGGGAGAAAGGGGGAGGGAGAGG + Intergenic
1146297200 17:31659282-31659304 AGGGAGAAAGGGGGAGGGAGAGG + Intergenic
1146297216 17:31659328-31659350 AGGGAGAAAGGGGGAGGGAGAGG + Intergenic
1146853007 17:36239587-36239609 AAGGAAAAAGAGGCTGAGAATGG + Intronic
1146868916 17:36363467-36363489 AAGGAAAAAGAGGCTGAGAATGG + Intronic
1147071791 17:37964099-37964121 AAGGAAAAAGAGGCTGAGAATGG + Intergenic
1147083318 17:38043625-38043647 AAGGAAAAAGAGGCTGAGAATGG + Intronic
1147099262 17:38167599-38167621 AAGGAAAAAGAGGCTGAGAATGG + Intergenic
1147168300 17:38604807-38604829 GTGGAGGGTGGGGCTGGGAAGGG - Intronic
1147609779 17:41794631-41794653 CTGGAGGAGGAGGCTGGGAAGGG - Intergenic
1147617683 17:41839484-41839506 AAGGATTAAGGGGATGGGAAGGG + Intronic
1147647515 17:42042792-42042814 ATGGGGGAAGGGCTTGGGAAGGG - Intronic
1147754314 17:42758328-42758350 AAGCAGAAAGGGGCTTAGAAAGG + Intergenic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1147878582 17:43639267-43639289 ATCGAGAAAGGGGCTTGCATGGG + Intergenic
1147951125 17:44108619-44108641 ATGGGGAGAGGGGGTGGGGAGGG + Intronic
1147985335 17:44303772-44303794 AGAGAGAAACGGGCTGGGGACGG - Intergenic
1148054742 17:44787386-44787408 AGGGAGAAAAGGGGTGGGACAGG - Intergenic
1148432192 17:47650722-47650744 AGGGAGAAAGAGGGAGGGAAGGG + Intronic
1148536135 17:48440602-48440624 AAGGAGAAAATGCCTGGGAAAGG + Intergenic
1148955679 17:51351800-51351822 AGGAAGGAAGGGGCAGGGAAGGG - Intergenic
1149414948 17:56449380-56449402 ATGGAGAGAGGGAGAGGGAAAGG - Intronic
1149488321 17:57062664-57062686 ATACAGAAATGGGCTGGGCACGG - Intergenic
1149564458 17:57631153-57631175 ACTCAGAAAGGGGCTGGGAGAGG - Intronic
1149747383 17:59112258-59112280 ATGAAGAAATGGACTTGGAAAGG - Exonic
1149837033 17:59922329-59922351 AAGGAAAAAGAGGCCGGGAACGG - Intronic
1150082282 17:62250897-62250919 AAGGAAAAAGAGGCTGAGAATGG + Intergenic
1151229485 17:72673391-72673413 ATAGAGAAAGAGGCCGGGCACGG - Intronic
1151274196 17:73021615-73021637 AAGGGGAAAGAGGCTGGGAGCGG - Intronic
1151338849 17:73456853-73456875 TTGGAGATAGGGTTTGGGAAGGG + Intronic
1151430499 17:74059331-74059353 AAAGGGAAGGGGGCTGGGAAAGG + Intergenic
1151443411 17:74148207-74148229 ATGCAGAAAGGAGGTGGGGAGGG - Intergenic
1151748117 17:76022358-76022380 CTGGAGAAACGGGCTGGGGCTGG + Intronic
1151978053 17:77493308-77493330 AGGGAGACAGGAGCTGGGATGGG + Intronic
1152057693 17:78043742-78043764 ATGAAGATAGAGGCTAGGAAGGG - Intronic
1152136169 17:78505051-78505073 AGGGAGAAAGGGGAGGGGAAAGG - Intronic
1152262100 17:79272834-79272856 CTGGAGAAAGATGTTGGGAAAGG - Intronic
1152417339 17:80171158-80171180 AGGGAGGAAGGGGAGGGGAAGGG - Intronic
1152425502 17:80216393-80216415 ATAGAGACAGGGGATGGGGAGGG + Intronic
1152566538 17:81102912-81102934 ATGGAGAAAGGTTCTGGGACTGG - Intronic
1152609228 17:81307461-81307483 AAGGAGAAAGGGAAGGGGAAGGG - Intergenic
1153021889 18:636915-636937 AAGGAGAAAGGGGCTGGGCATGG - Intronic
1153314314 18:3707055-3707077 ATGGAGAAATGGGTTGTTAAGGG + Intronic
1153472252 18:5460040-5460062 AGGGAGAGAGGAGCAGGGAAAGG - Intronic
1153687179 18:7557982-7558004 GGGGAGAATGGGACTGGGAATGG - Intergenic
1154068169 18:11128845-11128867 CTGGAGAACAGGCCTGGGAATGG + Intronic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1154505899 18:15040574-15040596 ATGGAGAACAGGAATGGGAATGG + Intergenic
1155321723 18:24625596-24625618 AGGGAGAAGAGGGTTGGGAATGG + Intergenic
1155507122 18:26545440-26545462 ACTGAGAAAGGGGCTGCGAGTGG - Intronic
1156465371 18:37345349-37345371 GTGGAGAGAGGGGCAGGGAGAGG + Intronic
1156682303 18:39605849-39605871 ATGGAGTAAGGGGAGGGAAAAGG - Intergenic
1156870383 18:41938821-41938843 ATCTAGAAAGTGGCTGGGTATGG + Intergenic
1157066712 18:44358566-44358588 CTAGAGGAAGGAGCTGGGAAGGG - Intergenic
1157124177 18:44939230-44939252 GTGGGGACCGGGGCTGGGAAGGG - Intronic
1157165977 18:45358866-45358888 GTGGGGAAAGAGGCTGGGCATGG - Intronic
1157279066 18:46334070-46334092 ATGTCGAGAGGGGCCGGGAAGGG + Intronic
1157287299 18:46385709-46385731 TTGGAGCAAGAGGCTGGGGAGGG - Intronic
1157301942 18:46485455-46485477 ATGGAGATTGGTGCTGAGAAGGG + Intronic
1157331204 18:46705090-46705112 AGTGGGAAAGGGGCAGGGAATGG - Intronic
1157422678 18:47559568-47559590 AAGGAGAAAGGGGAAGGGGAAGG - Intergenic
1157732249 18:50014256-50014278 ATGGAGAAAATGGATGAGAAAGG + Intronic
1157789297 18:50517047-50517069 ATGGGGACAGGGGAGGGGAAAGG + Intergenic
1158409024 18:57187849-57187871 ATGGGGAATTGGGGTGGGAAGGG + Intergenic
1158452310 18:57578198-57578220 GTGGGGAGAGGGGCTGGGAGGGG + Intronic
1158488976 18:57893178-57893200 AAGGAGCAAGGGGCTGGAGATGG + Intergenic
1158728052 18:59992903-59992925 ATGGGGAAAGAGGGTCGGAAGGG - Intergenic
1159026547 18:63187673-63187695 ATGGAGACAGAGGCTTGGAATGG + Intronic
1159348799 18:67242988-67243010 ATGGAAAAATGTGCTGGGAAAGG - Intergenic
1159503003 18:69298097-69298119 ATGGAGAAGGGGCGAGGGAAAGG - Intergenic
1160571571 18:79820936-79820958 ATGGGCAAAGGGGCTAGGCATGG - Intergenic
1160676569 19:394325-394347 ATGGAGAAGGATGATGGGAAAGG + Intergenic
1160676843 19:395529-395551 ATGGAGAAGGGTGATGGGGAAGG + Intergenic
1160691789 19:463744-463766 AAGGCGAGAGGGGCTGGGAAAGG - Exonic
1160777431 19:862490-862512 GTGGAGGAAGGGGCGGGGCATGG + Intronic
1160972231 19:1774726-1774748 ATGGAGAAGGGGGCTGGAGGGGG + Intronic
1161288312 19:3479870-3479892 AAGGAGGAAGGGGCTCGGATGGG + Intronic
1161300309 19:3539284-3539306 AGGGAGGGAGGGGCTGGGAGGGG - Intronic
1161440182 19:4286897-4286919 ATTAAGAAAGGGGCTGGGTAAGG + Intronic
1161513323 19:4683422-4683444 ATGGGGAAGGGGGCAGGGAGGGG + Intronic
1161617329 19:5278898-5278920 ATGAAAAAAGGGGTTGGGCATGG + Intronic
1161619647 19:5291335-5291357 ATGGAGGAGGGGGCTGGGCTGGG + Intronic
1161741551 19:6024068-6024090 ATGGGAAAATGGGCTGGGCACGG - Intronic
1161746234 19:6061805-6061827 TCTGAGAAAGGGGCTGGGAGGGG + Intronic
1161756161 19:6135749-6135771 AGGGTGACGGGGGCTGGGAAGGG + Exonic
1161915519 19:7225330-7225352 CTGGAGAAAGTGTCGGGGAAGGG - Intronic
1161988950 19:7673095-7673117 CAGGAGAGAGGGTCTGGGAAGGG - Intergenic
1162111396 19:8401810-8401832 AGGGAAGAAGGGGCTGGGCATGG - Intronic
1162199882 19:9012123-9012145 ATGGAGAGAAGGGAAGGGAAGGG + Intergenic
1162537598 19:11272642-11272664 AGGGGGAAAGGGGCTGGGCAAGG - Intergenic
1162947023 19:14050209-14050231 ATGAAGCAAGGGGCTGGGCAAGG + Intronic
1163093340 19:15036451-15036473 GTGGAGAAAGGGCCTGGGGCAGG + Intergenic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163351368 19:16777980-16778002 ATGGAGGAAGGGGGAGGGAAGGG + Intronic
1163398168 19:17076053-17076075 AAGGAGAAAGTGGATGGGGATGG + Intronic
1163577956 19:18121736-18121758 ATGGCGACAGGGGCCGGGAGAGG - Exonic
1163693649 19:18751231-18751253 ATGGGGAAATGGGCTGGGTGTGG + Intronic
1163897014 19:20068139-20068161 TTGAGGAAAGGGGCTGGGTAAGG - Intergenic
1164079480 19:21850260-21850282 CTGTAGAAAGGGCCTGGGCAGGG + Intronic
1164442214 19:28287870-28287892 AGAGAGAAGGGGACTGGGAAGGG + Intergenic
1164508682 19:28880053-28880075 ATGGTTACAGGGGCTGGGAAGGG - Intergenic
1164524568 19:29003922-29003944 ACAGAGAAAGGGGGTGGGGATGG - Intergenic
1164549305 19:29195047-29195069 GTGAAGAAGGGGGCGGGGAAAGG + Intergenic
1164614696 19:29660032-29660054 TTGTGGAATGGGGCTGGGAAAGG - Intergenic
1164913201 19:32028703-32028725 ATTGAGGAAGTGGCTGGCAAAGG - Intergenic
1165317805 19:35067197-35067219 ATGGAGAAAGGGGTTGGGGGAGG - Intergenic
1165352708 19:35284867-35284889 AGGGAGCAGGGGGCTAGGAAAGG - Intronic
1165393135 19:35549702-35549724 GTGAACAGAGGGGCTGGGAAAGG + Intergenic
1165893401 19:39127833-39127855 ATGGGGAGGAGGGCTGGGAATGG + Intronic
1166045158 19:40225656-40225678 GTCGAGTAAGGGGCTGGGGAAGG - Intronic
1166099112 19:40560468-40560490 ATTGAGAAGGGGGCTGTCAATGG - Intronic
1166135677 19:40775742-40775764 ATGGAGATAGGGTCTAGGGAAGG - Exonic
1166348028 19:42178973-42178995 ATGGAGAAAGGCACTGGAAGAGG + Intronic
1166410772 19:42554329-42554351 CAGTAGAAAGGGGCTGGGGAGGG + Intronic
1166492202 19:43269403-43269425 GTGCAGGAAGGGGCTGGGAGGGG + Exonic
1166757189 19:45200470-45200492 AAGCAGAAAGGGGCTGGGCACGG - Intronic
1166776501 19:45316037-45316059 ATAGAGACAGGGGCTGGGCGCGG + Intronic
1166803803 19:45473246-45473268 TTGGGGACAGGGGGTGGGAAGGG + Exonic
1166834597 19:45659461-45659483 ATGGAAAAAGGGGAAGAGAAAGG + Intergenic
1166861762 19:45815528-45815550 AGGGGGAAAGGGGGTGGGACAGG - Exonic
1166905560 19:46106174-46106196 ATGAAGAAAGGTGCTGAGATAGG + Intergenic
1167424010 19:49420417-49420439 ATGGCGAAAGGGGCAGGACAAGG + Intergenic
1167477631 19:49710136-49710158 ATGGGGATAGGGGCTGGGCGTGG - Intronic
1167677294 19:50895214-50895236 CTGGAGAAAGTGCTTGGGAATGG + Intergenic
1167682588 19:50933432-50933454 ATGAAGAAAGGGGCCGGGCATGG - Intergenic
1167721456 19:51182900-51182922 AAGGAGAAAAGGGAAGGGAAGGG - Intergenic
1167734135 19:51281459-51281481 AGGGAGAACTGGGCTGGAAAAGG + Intergenic
1167763520 19:51463870-51463892 AAGGAGAAAAGGGAAGGGAAGGG + Intergenic
1168091085 19:54084829-54084851 ATAGAGAAGGCGGCTGGGCATGG + Intergenic
1168145248 19:54416600-54416622 TGGGAGAAGGGGGCTGGGATTGG + Intronic
1168586661 19:57599698-57599720 ATGGAGAAAGGTGGAGGGGAAGG - Intergenic
925287744 2:2726973-2726995 ATGAGGGAAGGGGCTAGGAAAGG + Intergenic
925356496 2:3245501-3245523 ATGGGGAATGAGGCTGGGCATGG - Intronic
925372931 2:3360909-3360931 ATGGGGAAAGGGGAGGGGGAAGG + Intronic
925580734 2:5407287-5407309 ATTGAGAAATGGGCTGGGCGCGG - Intergenic
925702234 2:6650402-6650424 ATGAAAAAAGAGGCTGAGAAGGG + Intergenic
925755513 2:7128306-7128328 AGGGAGAAAGGGGAGGGGGAAGG - Intergenic
926106075 2:10152236-10152258 ATGGGCAAAGGGGCCGGGCATGG - Intronic
926245730 2:11121488-11121510 ATGGTGAAAGGGGACAGGAAGGG - Intergenic
926913988 2:17876423-17876445 ATGGAGACTGGGGTTGGGGAAGG + Intergenic
927329993 2:21851384-21851406 ATTGAGGAAGGTGCTGGGTATGG + Intergenic
927656939 2:24956879-24956901 ATAGAGAAAGGGGGAGAGAAAGG - Intronic
928163875 2:28955281-28955303 ATGGAGAAAGGTGTGGGGAGAGG - Intergenic
928178526 2:29051474-29051496 ATGGAGAAAGGGGCACGCAAAGG - Intronic
928245348 2:29621870-29621892 ATTTAGAGAGGGACTGGGAAGGG + Intronic
928360956 2:30661994-30662016 AATGAGAAAGGAGCTAGGAAGGG - Intergenic
929119869 2:38475898-38475920 ATGGTGGAGGGGGCTGGGCATGG - Intergenic
929520379 2:42644863-42644885 AGAGAGAAAGAGGCAGGGAAGGG - Intronic
929608285 2:43250572-43250594 AAAAAGAAAGGGGCTGGGCATGG + Intronic
929715616 2:44306401-44306423 ACGGAGAAAGGCTCTGGCAATGG - Intronic
929787845 2:45004899-45004921 GTGGAGAAAGAGGCTGGCAAGGG + Intergenic
930144045 2:47982933-47982955 ATGGGGGAAGGGGCTTGGCATGG + Intergenic
930235011 2:48880425-48880447 ATGGACAAAGGGTATGAGAAAGG + Intergenic
930846905 2:55916398-55916420 ATGAAGCAAGGGGCTGGGCACGG - Intronic
930976169 2:57464344-57464366 ATGGACTAAGGGGCGGGGCATGG - Intergenic
931266868 2:60668270-60668292 ATTGGGAAAGGGACTGGGCATGG - Intergenic
931470405 2:62533513-62533535 AAAGAGAAAGAAGCTGGGAATGG - Intergenic
931494470 2:62787399-62787421 ATGGAGCAAGGGGGTGGGGGGGG - Intronic
932296061 2:70624255-70624277 ATGGAAAAAGGAGTGGGGAAAGG - Intronic
932329078 2:70887550-70887572 CTGGACAAAAGGGCAGGGAAGGG + Intergenic
932493074 2:72133738-72133760 ATGGAGGAAGGGGCTGGCACTGG - Intronic
932661848 2:73661537-73661559 ATGGGCAAAGGGGCTGGGCACGG - Intergenic
933592051 2:84243824-84243846 GAGGAGAAAGGTGCTGGAAATGG + Intergenic
933603703 2:84359813-84359835 TTGGGGTAAGGGGCTGGGGAGGG + Intergenic
933650064 2:84843376-84843398 AAGGAGAAAGGGGTTGGGGCTGG - Intronic
933678305 2:85077135-85077157 ATGGAGGCAGGGGCTGAGATGGG + Intergenic
933686837 2:85148205-85148227 ATGCAGGAAGGGGCTGGGATGGG + Intronic
933759037 2:85661832-85661854 ATGGAAAAGGGGGATGGGAAGGG - Intronic
933815042 2:86059903-86059925 ATGGAGAGTGGGGTTGGGGAGGG + Intronic
933883165 2:86692225-86692247 AAGGATAATGTGGCTGGGAAGGG + Intronic
933993936 2:87654123-87654145 AGGGTGAGAGGGGCAGGGAAGGG - Intergenic
934182822 2:89642728-89642750 CTGGAGAAAGGCACTGGGAAAGG - Intergenic
934293114 2:91716917-91716939 CTGGAGAAAGGCACTGGGAAAGG - Intergenic
934557568 2:95295524-95295546 AAGGAGGATGGGGCTGGGCACGG + Intergenic
934571606 2:95376233-95376255 CAGGAGAGAGGGGCAGGGAAAGG - Intronic
934636576 2:95994670-95994692 ATGAAGAGTGGGGATGGGAAGGG - Intergenic
934664334 2:96159170-96159192 GAGGAGAACGGGTCTGGGAAGGG - Intergenic
934767053 2:96885504-96885526 ATGGCGCATGGGGCTGGGGAGGG + Intronic
934797072 2:97110756-97110778 ATGAAGAGTGGGGATGGGAAGGG + Intergenic
934836340 2:97592673-97592695 ATGAAGAGTGGGGATGGGAAGGG - Intergenic
934888025 2:98041475-98041497 ATGCACTAAGGGGCTGGGCACGG + Intergenic
934919990 2:98335299-98335321 ATGGAGAGAGTGGGTGGGATGGG + Intronic
935330676 2:101975124-101975146 ATGGGTAGAGGGGCTGGGACTGG + Intergenic
935532164 2:104247684-104247706 AGGGAAAGAGGGGCTGGGGAAGG + Intergenic
936299929 2:111296791-111296813 AGGGTGAGAGGGGCAGGGAAGGG + Intergenic
936349910 2:111704634-111704656 TTGGTGAAAGGGGATGGGGAAGG + Intergenic
936658227 2:114513014-114513036 AAGGAGGAAGGGGGAGGGAAGGG + Intronic
937062773 2:118992684-118992706 AAGGAGAAAGGGGGAAGGAAGGG - Intronic
937088376 2:119187252-119187274 GAGGAGAAAGGGGCTGGAAATGG - Intergenic
937301422 2:120844980-120845002 AAGGAGAAAGAAGCTGGGCACGG + Intronic
937626506 2:124050170-124050192 ATAAAGAAATGGGCTGGGCATGG + Intronic
938115525 2:128600784-128600806 AGGCAGAAAGGGGGAGGGAAGGG - Intergenic
938784395 2:134611954-134611976 TGGGAGGAAGGGGATGGGAATGG - Intronic
939069243 2:137518955-137518977 AAGGGGAAAGGGGCTGGGCACGG + Intronic
939107206 2:137963129-137963151 AGGGAGTTGGGGGCTGGGAATGG + Intergenic
939232381 2:139446287-139446309 ATGGTGAAAGGGGGGAGGAAAGG - Intergenic
940716208 2:157227358-157227380 GAGTAGAAAGAGGCTGGGAAGGG - Intergenic
941158891 2:162012814-162012836 GTGGAGAGATGGGCTGGGGAGGG - Intronic
941911493 2:170769418-170769440 ATGGATTAATGGGCTGGGCACGG - Intergenic
941925083 2:170886199-170886221 AGGGATTTAGGGGCTGGGAATGG + Intergenic
942086722 2:172450662-172450684 ATAGAGAAGGGGGCCGGGCATGG + Intronic
942150795 2:173074955-173074977 AAGAAGAAATGGGCTGGGCATGG - Intergenic
942389755 2:175479596-175479618 CTTGAGAAAGGGGCTAGAAAGGG - Intergenic
942607820 2:177710430-177710452 ATGGGGAATGGGGCTGGCTAGGG + Intronic
942932260 2:181508984-181509006 ATGAAAAAATGGGCTGGGCATGG + Intronic
943030847 2:182683827-182683849 ATGCAAAATGGGGCTGGGAGCGG + Intergenic
944035271 2:195287332-195287354 ATGGAGAAGGGGGCCTGAAAAGG + Intergenic
944175538 2:196824941-196824963 ATGGGTAAAGGGGCTGAGCATGG + Intergenic
944234714 2:197431408-197431430 AAGAAGAAAAGGGCTGGGCATGG - Intronic
944417894 2:199497058-199497080 ATGGAGATGGGGGATGGGAGGGG + Intergenic
944502240 2:200373928-200373950 AGGGAGAATTGGGCTGGGATAGG + Intronic
944898397 2:204189077-204189099 CAGGAGAAAGGGTCGGGGAAGGG + Intergenic
944932597 2:204535323-204535345 GTGGAGAAAGGAGTTGGGAAGGG + Intergenic
945238357 2:207653606-207653628 AGGCAGAGAGGAGCTGGGAAAGG + Intergenic
945397751 2:209340970-209340992 TTGGAGAAAGGGGCCAGGGAAGG + Intergenic
945499827 2:210557986-210558008 ATGGAGACAGGGGGAGGGGAAGG + Intronic
945740734 2:213657969-213657991 AAGGAGAAAGGGATTGAGAATGG - Intronic
945801296 2:214434601-214434623 ATGAGGAAATGGGCTGAGAAAGG - Intronic
945960983 2:216134724-216134746 AAGAAGGAAGGGGCTGGGCACGG - Intronic
946490122 2:220140657-220140679 ATGGGCAAAGGGGCTGGGCGCGG - Intergenic
946557166 2:220871818-220871840 ATGGAGACTGGAGATGGGAATGG + Intergenic
946669688 2:222089485-222089507 ATGGAGAAAGTGATAGGGAAGGG - Intergenic
947534602 2:230933062-230933084 AGGCAGGAAGGGGCAGGGAAAGG - Intronic
947749105 2:232523661-232523683 AGGCAGAAGGGAGCTGGGAATGG - Intronic
947932646 2:233976394-233976416 TTGGAGAAAGGCCCTGGGCAGGG + Intronic
948048003 2:234958350-234958372 ATGGTGAGCGGGGCTGGGACTGG + Intronic
948049104 2:234966086-234966108 GAGGAGAAAGAGGCTGGGCACGG + Intronic
948413051 2:237779412-237779434 ATGCAGAGCGGAGCTGGGAACGG - Intronic
948524327 2:238560798-238560820 TTGGAGAAAGGAGGTTGGAAGGG + Intergenic
948677648 2:239608185-239608207 ATGGAGAAAGGGAGTGTAAAGGG - Intergenic
948699156 2:239749616-239749638 TTGGAGGCAGGGACTGGGAAAGG + Intergenic
948740754 2:240044282-240044304 CAGGAGAAAGAGGCTGGGTATGG - Intergenic
948753371 2:240144950-240144972 AGGGTGACAGGGGCTGGGATGGG - Intergenic
948764033 2:240210458-240210480 ATAGAGAACGGGGCTGGGGCGGG - Intergenic
948863096 2:240762380-240762402 ATGGGGAATGGGGCTGGTAGGGG - Intronic
949053931 2:241914382-241914404 GTGGAGAAAGGGGGTGTGAAGGG + Intergenic
1168731134 20:82027-82049 AAGGAGAAATAGGCTGGGCATGG + Intergenic
1168756487 20:322030-322052 AGGGAGGGAGGGGCTGGGCAAGG - Intergenic
1168862414 20:1055287-1055309 ATGGTGACAGGGACTGAGAAAGG - Intergenic
1169241671 20:3986545-3986567 AAGAAGAAAGGCGCTGGGCATGG - Intronic
1169264637 20:4160441-4160463 ATGGAGTGAGGGGCAGGGCAGGG - Intronic
1169854129 20:10085009-10085031 AAGGAAAAAGGGCCAGGGAATGG - Intergenic
1170427425 20:16248807-16248829 AGGGAGAAGTGGGCAGGGAAGGG - Intergenic
1170448443 20:16455881-16455903 ATGGAGGAAAGGGCTGGAAAGGG - Intronic
1170717195 20:18842181-18842203 CTGGGGAAATGGTCTGGGAAGGG - Intergenic
1170991384 20:21304551-21304573 GTGGAGAAATGGGATGAGAAGGG - Intronic
1171010393 20:21506173-21506195 ATGGAAACCGGGGCTGGGACGGG + Intergenic
1171071506 20:22073181-22073203 ATGGGGAAATGGGATGGAAATGG + Intergenic
1171189183 20:23146583-23146605 AGTGAGGAAGGGGCTGGGCAAGG + Intergenic
1171362789 20:24600903-24600925 ATGAAGACATGGGCTGGGCATGG - Intronic
1171990060 20:31689234-31689256 AGGAAGAAAGGGGAAGGGAAAGG + Intronic
1172006575 20:31822571-31822593 ATAGGGAAAGGGCCTGGGCAGGG + Intronic
1172387865 20:34546754-34546776 ATGGAGGATGGGGATGGCAAAGG + Intergenic
1172842179 20:37908520-37908542 ATGGAGAGATTGGCTGGGCACGG + Intronic
1172956286 20:38761877-38761899 GTGGAGAAGGGTGTTGGGAAAGG + Intronic
1173036184 20:39413363-39413385 ATGGAAAAAGGGGTGGGGAAGGG + Intergenic
1173201308 20:40957262-40957284 ATGGATAAAGGGGCAGGAAGGGG - Intergenic
1173471832 20:43329985-43330007 ATGGAGCAAGGGACAAGGAAAGG + Intergenic
1173592044 20:44232237-44232259 ATAGGGAAAGCGGCTGGGCACGG + Intergenic
1173812253 20:45963265-45963287 ATGTGGGGAGGGGCTGGGAAGGG - Intronic
1174253387 20:49236031-49236053 ATGGGGATAGAGGCTGGGCACGG - Intronic
1174416901 20:50373423-50373445 ATGGAGGAAAGGGCTGGGTGTGG + Intergenic
1174515741 20:51091152-51091174 GTGGAAAAATGGGCTGGAAATGG - Intergenic
1174717349 20:52773725-52773747 ATAGAGAAATTGGCTGGGTATGG - Intergenic
1175131910 20:56795672-56795694 AAGGAGAATGGGGTTGGGAATGG + Intergenic
1175196222 20:57245015-57245037 AGGGAGACAGGGGCTGGGCATGG - Intronic
1175221181 20:57417404-57417426 ATGGAGAAATGGTTGGGGAATGG + Intergenic
1175221207 20:57417525-57417547 ATGGAGAAATGGATGGGGAATGG + Intergenic
1175303076 20:57956784-57956806 GGGCAGAAAGGGGCTGGGCAAGG - Intergenic
1175322906 20:58101995-58102017 ATGGAAAAAGGGGCCAGGCACGG + Intergenic
1175482174 20:59319420-59319442 ATGCAGCGAGGGGCTGGGCATGG + Intronic
1175655536 20:60766523-60766545 ATGCAGAAATTGGCTGGGAAAGG + Intergenic
1175663375 20:60836818-60836840 AGGCAGAGAGAGGCTGGGAATGG - Intergenic
1175838930 20:62014489-62014511 GTGGGGAGAGGGGCTGGGCAGGG + Intronic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176185768 20:63778013-63778035 CTGCAAAAAGGGGCTGGGGAGGG + Intronic
1176387128 21:6143743-6143765 ATGAAGAAAGGAGTTAGGAAGGG - Intergenic
1176729658 21:10480553-10480575 TTGGAGAAAAGCACTGGGAAAGG + Intergenic
1177366643 21:20148300-20148322 AAGGGGAAAGGGGCTGAGCATGG - Intergenic
1177592185 21:23185188-23185210 CTGGAGCAAGGGCCTAGGAAGGG - Intergenic
1177722903 21:24929847-24929869 ATAGAGAAAGGGACTGTGAGAGG - Intergenic
1177991355 21:28039455-28039477 ATGGAGAACAGGAATGGGAATGG - Intergenic
1178074930 21:29006100-29006122 AGGGAGAAGGGGGTTGGGAATGG + Exonic
1178087849 21:29130675-29130697 AAGGAGAGAGGGGTTGTGAAGGG + Intronic
1178390986 21:32198209-32198231 AAGGAAAGAGGGCCTGGGAAGGG + Intergenic
1178459238 21:32787001-32787023 ATGTAAAAATGGGCTGGGCATGG + Intergenic
1179306292 21:40156334-40156356 AGAGAGAAAGGGGCTTGTAAAGG + Intronic
1179444975 21:41424706-41424728 AAGGTGAAAGGGGTTGGGGAGGG - Intronic
1179557390 21:42188527-42188549 AGGGAGAAGGGGGCTGGGCAAGG + Intergenic
1179723321 21:43328320-43328342 CTGGAGAAGGGGGCTGGGCCTGG + Intergenic
1179736345 21:43394509-43394531 ATGAAGAAAGGAGTTAGGAAGGG + Intergenic
1179942827 21:44650765-44650787 ATGGGGCTGGGGGCTGGGAAAGG + Intronic
1180172197 21:46065388-46065410 ATGGGGAAAGGGGCCAGGAGTGG - Intergenic
1180738920 22:18039619-18039641 AGGGAGCAAGAGGCTGGGCATGG + Intergenic
1180868674 22:19134046-19134068 CTGGAGAAAGGGGCTGTGCTGGG - Exonic
1181020540 22:20099527-20099549 CTGGGGAGAAGGGCTGGGAATGG + Intronic
1181143244 22:20823202-20823224 ATGGAAAAAGTGGCTGGGTGCGG - Intronic
1181185344 22:21099359-21099381 AGTGAGAAAGTGGCCGGGAACGG - Intergenic
1181429074 22:22866794-22866816 ATGTAGTAAGCGGGTGGGAAGGG + Intronic
1181534424 22:23534254-23534276 GTGGAGCAAGGGGGTGGGAGGGG - Intergenic
1181601584 22:23955377-23955399 ATGGGGAGAGGGGGTGGTAATGG + Intergenic
1181606916 22:23985921-23985943 ATGGGGAGAGGGGGTGGTAATGG - Intergenic
1181639497 22:24189244-24189266 ATGGAGAGAGAGCCTGGGGAGGG - Intergenic
1181751368 22:24991311-24991333 AGGAAGAAAGGGGCTGGGCATGG - Intronic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182069937 22:27456360-27456382 ATGGGGAAAGGGGCTGAGTGCGG + Intergenic
1182108585 22:27706652-27706674 GTGGAGAAGGGGGTTGGGAAAGG - Intergenic
1182282356 22:29224915-29224937 CTGGAAAGAGGGGCTGGCAATGG - Intronic
1182282828 22:29226972-29226994 ATAGAGAAAGGGGATGGGGCAGG - Intronic
1182434528 22:30321839-30321861 ATAGAGGAAGTGGTTGGGAAGGG - Intronic
1182487303 22:30647105-30647127 ATGGAGAACAGGGCTGGGCATGG + Exonic
1182832764 22:33316921-33316943 ATGGGAAAATGGGCTGGGCACGG + Intronic
1182931363 22:34177295-34177317 AAGGAGAAAGGGACAGAGAAAGG - Intergenic
1183029861 22:35095479-35095501 ATGGAGAAGGAGGTTGGGAATGG + Intergenic
1183068103 22:35377586-35377608 ATGGAGGATGAGGCTGGGCACGG - Intergenic
1183176105 22:36225840-36225862 CTGTAGAAGGGGGCTGGAAAAGG - Intergenic
1183189053 22:36309957-36309979 ATAGAGATAGGGGCTGGGTGCGG + Intronic
1183298810 22:37048196-37048218 AGGGAGAAAGGGGGAGGGAAGGG - Intergenic
1183481118 22:38066100-38066122 ATGGCTAAAGGGGCTGGAATAGG - Intronic
1183513869 22:38251778-38251800 GTGGGGAAAGGGGTGGGGAAGGG + Intronic
1183847101 22:40551124-40551146 ATGTATAAAGAGGCTGGGCACGG - Intronic
1183985135 22:41565627-41565649 ATGCAGAATGGGGCAGGAAATGG - Intronic
1184612474 22:45613514-45613536 ATGGAGAAAGGAGCCTCGAAGGG + Intergenic
1184807925 22:46808065-46808087 ATGCAGTAAGGGGCTGGGCACGG + Intronic
1185080100 22:48704948-48704970 ATGGTGCAGGGGGCTGGGGAGGG + Intronic
1185088034 22:48751194-48751216 GTGGCGAAAGGGGCAGGAAATGG - Intronic
949090413 3:21309-21331 ATGGAGATAAGGTCAGGGAAAGG + Intergenic
949445312 3:4128749-4128771 CTGGAGAACGGGCATGGGAATGG + Intronic
949735423 3:7166498-7166520 GTGGAGACAGTGGCTGGGGAAGG - Intronic
949740637 3:7229694-7229716 ATGGAGAGCGGGGTTGGGGAAGG - Intronic
949966512 3:9361392-9361414 ATGTGCAAAGGGGCTGGGAGTGG - Intronic
950044608 3:9941498-9941520 ATTGAGGAAGGGGCTGGGCGCGG + Intronic
950065848 3:10111097-10111119 GTGAAGACAGGGGCTGGGCACGG + Intergenic
950130949 3:10546413-10546435 CTGGACAGAGGGGCTGGGCAGGG - Intronic
950144697 3:10640697-10640719 ATGGGGAATGGGGTGGGGAATGG - Intronic
950198438 3:11026132-11026154 CCGGAGGAGGGGGCTGGGAATGG - Intronic
950212042 3:11130851-11130873 CTGGAGGAGGGGGCTGGGCAAGG - Intergenic
950543976 3:13628079-13628101 AGGGACAAGGGGGCTGGGAGAGG - Intronic
950790254 3:15465894-15465916 CTAGAGAAAGAGGCTGGGCATGG - Intronic
951102821 3:18709213-18709235 AGGAAGAAATGGGCTGGGCATGG + Intergenic
951206750 3:19933802-19933824 ATTGAGCAAGGGGCTTGAAATGG - Exonic
951274208 3:20665399-20665421 ATGGAGAAAGGGAGAGGGAGAGG - Intergenic
951658044 3:25031227-25031249 ATGGGGAGAGGGGTTTGGAAGGG - Intergenic
951704102 3:25526445-25526467 ATTGGGCAAGGGGCTGGGAATGG + Intronic
951795928 3:26538234-26538256 AAGGAGAAGGGGGAGGGGAAGGG + Intergenic
952189253 3:31005158-31005180 AGAGAGAAAGAGGCTAGGAAGGG - Intergenic
952221914 3:31331946-31331968 AGGGAGCTAGGGCCTGGGAATGG - Intergenic
952970303 3:38646570-38646592 ATGGAGATCTGGGCTGGAAATGG - Intronic
953299821 3:41762291-41762313 ATGGTAACAGGAGCTGGGAAGGG - Intronic
953499198 3:43416775-43416797 TTGGATTAAGAGGCTGGGAATGG - Intronic
953507119 3:43497017-43497039 ATGGGGATAGGGGATGGGACTGG + Intronic
953620656 3:44529909-44529931 CTTTAGAAAGGGGGTGGGAAGGG - Intergenic
953639014 3:44688239-44688261 AGGGAGAAAGGGGGTGGTAATGG - Intergenic
953852001 3:46471622-46471644 ACGGAGAAAGGAGCAGGGAGCGG + Intronic
954199547 3:49016092-49016114 GGGGAGAAAGGTGCTGGGAGGGG + Intronic
954234439 3:49245474-49245496 ATTGAGAATGGGGCTGGGCGTGG - Intronic
954434110 3:50486903-50486925 CTGGAGGACAGGGCTGGGAAAGG + Intronic
954464314 3:50645793-50645815 ATGGAGGCAGGGGGTGGGGAAGG - Intronic
954716703 3:52530395-52530417 ATGGAGAAAGTGGAAGGGAAAGG + Intronic
955056860 3:55462666-55462688 AAGCAGAAAGGGGATAGGAAAGG - Intergenic
955058852 3:55479802-55479824 ATGGTGACAGGGGCTAGGAAGGG - Intronic
955093749 3:55776600-55776622 GTACGGAAAGGGGCTGGGAAGGG + Intronic
955170401 3:56558148-56558170 AGGGAGAGAGAGGCTGGGAAAGG - Intronic
955249847 3:57269184-57269206 ATGGAGAAAAGGGCTGGAGAGGG + Exonic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
957030309 3:75233070-75233092 ATGGAGATAAGGTCAGGGAAAGG + Intergenic
957128401 3:76192425-76192447 AAGGAGAAAAGTGCTAGGAAAGG - Intronic
957485073 3:80850302-80850324 ATGGTGGAAGGGGAAGGGAAAGG - Intergenic
959058061 3:101587980-101588002 ATGGAGAAATTGACTGGGCATGG + Intronic
959377686 3:105605460-105605482 ATGGAGAACCGGCATGGGAATGG - Intergenic
959942364 3:112092770-112092792 ATGTAAAAAAGGGTTGGGAAGGG - Intronic
960223870 3:115147448-115147470 AGGAAGAAAGGGGCGGGGACGGG - Intergenic
960305184 3:116051818-116051840 ATGGTGCAGGGGGCTGGGGAGGG + Intronic
960736571 3:120787551-120787573 ATGCAAAAATGGGTTGGGAAGGG + Intergenic
960801141 3:121541832-121541854 TTGAAGAAAAGGGCTGGGCATGG + Intronic
960864715 3:122187614-122187636 AAGGAGGAAGGGTCAGGGAAAGG + Intronic
961675960 3:128566894-128566916 GAGGAGGAAGGGGCTGGGCATGG + Intergenic
961713839 3:128845916-128845938 ATGGAGACAGGGGCGGGGCCAGG + Intergenic
962280461 3:134048415-134048437 AGGGATCAAGGGGCTGGGAAGGG - Intronic
962456368 3:135568819-135568841 CTGGAGAAAGGCCATGGGAAAGG + Intergenic
962470119 3:135699350-135699372 ATGGCGAGAGGGGATGGGATAGG + Intergenic
962784764 3:138757621-138757643 AGGGAGAGAGGGGAGGGGAAGGG + Intronic
963037600 3:141045998-141046020 AAGGGGAATGGGGCAGGGAATGG + Intergenic
963238317 3:142976919-142976941 ATGTAGAATTGGGCTGGAAAAGG + Intronic
963521841 3:146365698-146365720 ATGGAAAGAGGAGTTGGGAAAGG - Intergenic
963740740 3:149078253-149078275 ATGTTCAAAGGGGCTGGGCATGG + Intronic
963887394 3:150597776-150597798 ATAGTGAAAGTGGCTGGGAGCGG - Intronic
964228163 3:154431006-154431028 ATGGAAACAGGGGAAGGGAAAGG + Intergenic
964718355 3:159746689-159746711 ATAGGGAAAGAGGCTGGAAATGG - Intronic
964833310 3:160910196-160910218 AAGGGGAAAGGGACAGGGAAGGG - Intronic
964876787 3:161376615-161376637 ATGGAGAGAGGTGGTGGTAATGG - Intergenic
964877550 3:161385463-161385485 AGGGAGAAAGGGGAAGGAAAAGG + Intergenic
964966940 3:162506094-162506116 ATGGAAAAATGGGCTGGGCATGG + Intergenic
965034966 3:163426160-163426182 ATGAAGCAGTGGGCTGGGAAAGG - Intergenic
965431971 3:168599968-168599990 AAGCAGACAGGGGATGGGAATGG + Intergenic
965475492 3:169150025-169150047 AAGGAGAAAGGGAGTGGGATGGG - Intronic
965549356 3:169948294-169948316 CAGGAGAAAGTGGCTGGAAAGGG - Intergenic
965567567 3:170136934-170136956 AAGAAGAAAGGGGGAGGGAAGGG + Intronic
965575187 3:170210756-170210778 TTAAAGAAAGGGGCTGGGCATGG + Intergenic
965577055 3:170228307-170228329 ATACAGAAAGAGGCTGGGTATGG + Intronic
966135601 3:176694841-176694863 ATGAGGAAAGGGTCTAGGAAGGG - Intergenic
966186480 3:177231615-177231637 TTGGAGAAAGGGGGAAGGAAGGG - Intergenic
966190019 3:177263664-177263686 CTGGAGAGAGGAGCTGGGCAAGG + Intergenic
967217138 3:187220298-187220320 AAGGAGACTTGGGCTGGGAAGGG - Intronic
967668327 3:192201343-192201365 ATTCAGAAAGGGGCAGGCAAGGG + Intronic
967693214 3:192501221-192501243 TTGGAGAATAGAGCTGGGAAGGG + Intronic
967699404 3:192573948-192573970 AGGGTAAAAGAGGCTGGGAAAGG - Intronic
967848610 3:194064687-194064709 ATGGAGAAAGAGGAAGGGAGAGG + Intergenic
968266969 3:197369901-197369923 ATGGGGAAAGGGGAGGGGAAGGG - Intergenic
968270102 3:197396973-197396995 ATGGGGAAAGGGGCCGGGCGTGG + Intergenic
968336499 3:197918023-197918045 GAGGAGAAATGGGCTGGGCATGG - Intronic
968356911 3:198115638-198115660 ATGGATACTGGAGCTGGGAAGGG + Intergenic
968472278 4:787632-787654 ACGCAGGAAGGGGCAGGGAAGGG + Intronic
968649377 4:1754357-1754379 AGGGAGACAGGGGCTGTGATGGG + Intergenic
968873519 4:3253536-3253558 TTAGAGAAAGGGACTGGGAGTGG + Intronic
969018759 4:4124357-4124379 AGGAAGAAAAGGGCTGGGATAGG - Intergenic
969786534 4:9462157-9462179 AGGAAGAAAAGGGCTGGGATAGG + Intergenic
969806358 4:9612011-9612033 ATGAATAATGGGGCTGGGCATGG + Intergenic
969937301 4:10695034-10695056 ATGGAGGAGTGGACTGGGAAAGG + Intergenic
969971623 4:11053912-11053934 CTGGAGAAAGGAGCTAGGAGTGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
971360453 4:25933551-25933573 ATAGAGGTAGGGACTGGGAAGGG + Intergenic
971600555 4:28586188-28586210 AGGAAGAGAGGGGCAGGGAAAGG - Intergenic
972049797 4:34715348-34715370 AGGGAGAAAGGGAGAGGGAAGGG - Intergenic
972210552 4:36831478-36831500 ATGGCAAAAGAGGCTGGGCACGG + Intergenic
972445109 4:39136448-39136470 ATTAAGGAAGGGGCTGGGTATGG - Intergenic
973001748 4:44960904-44960926 ATGGGGAAAGGGGAAGGAAAAGG - Intergenic
973216579 4:47676045-47676067 ACTGAGAAAGGGGCTGAGAGAGG + Intronic
973265409 4:48205350-48205372 ATGGAGCACAGAGCTGGGAACGG - Intronic
973282660 4:48376161-48376183 ATGAAGGAAGGGGCTGGGCACGG + Intronic
973715471 4:53671340-53671362 AAGGAGGAAGGAGCTGGAAAAGG - Intronic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
975411375 4:74054968-74054990 AAGGAGAAAGAGGTAGGGAAGGG + Intergenic
975485110 4:74927149-74927171 AAGGAGAAAATGGCTGGGTATGG - Intergenic
975649301 4:76576484-76576506 ATGGTTACAGAGGCTGGGAAGGG + Intronic
975708063 4:77130267-77130289 ATGGGCAAAAGGGCTGGGCATGG - Intergenic
975907747 4:79235026-79235048 AAGGAGAAAGGGGCCAGAAAAGG + Intronic
976843572 4:89460639-89460661 ATGGAGCAAGGCCCTGGGAGAGG + Intergenic
977329385 4:95618373-95618395 GTGGACAAAGGGGCTAGGCATGG + Intergenic
977597218 4:98896386-98896408 ATGGGGACAGGGACAGGGAATGG + Intronic
978277375 4:106968057-106968079 ATGAAGAAAGGGGGAGAGAAAGG + Intronic
978303038 4:107292653-107292675 ATGGAGAAAGGAGTGGAGAAAGG + Intergenic
978902598 4:113970662-113970684 GAGGAGAGAGGGGCTGGGCAAGG + Intronic
979865751 4:125751153-125751175 ATGGAGAAAGTGGCAGAGAATGG - Intergenic
980198237 4:129619610-129619632 ATGGATAAAAAGGATGGGAAAGG - Intergenic
980844909 4:138312805-138312827 GAGGAGAAAGGGGCAGGGAAGGG - Intergenic
980970251 4:139560575-139560597 CTGGAGGGAGGGGCTGGGAGAGG + Intronic
981018912 4:140004735-140004757 AGGGAGAGCGGGTCTGGGAAGGG - Intronic
981033068 4:140145145-140145167 GTGGAGAAAGATGTTGGGAAAGG + Intronic
981086470 4:140689466-140689488 AGGGAAAAAGGGGAAGGGAAGGG - Intronic
981240562 4:142471843-142471865 ATGGAGGAAGGGGCTGGTGAAGG - Intronic
982025669 4:151251913-151251935 ATTGAGAAAGAGGATGGGAATGG - Intronic
982321173 4:154078733-154078755 ATGGAGAAAGGTGATTGGCAGGG + Intergenic
983173318 4:164559592-164559614 GTGGTGACAGAGGCTGGGAAGGG - Intergenic
983589271 4:169389764-169389786 ATGAAGAAATGGGCTGGGCATGG - Intergenic
983677219 4:170309648-170309670 AGAGAGAAAGGGGCTGGGGGAGG - Intergenic
984088361 4:175340061-175340083 ATGGAGAAAGGCCCTGGGTCAGG + Intergenic
984632565 4:182076181-182076203 AAGGAGAAAGAGGCTGGGCATGG - Intergenic
984632613 4:182076490-182076512 AAGGAGAAAGAGGCTGGGAGTGG - Intergenic
985230084 4:187806289-187806311 ATGGTTACAGAGGCTGGGAAGGG + Intergenic
985674470 5:1223887-1223909 AGGGTGAAAGGGGCTGGTAGGGG - Exonic
985939340 5:3121947-3121969 AGGGAGGAAGGGGCTGAGAAAGG - Intergenic
987047921 5:14124834-14124856 ATGGAGAAGGAGGCCGGGCATGG + Intergenic
987105074 5:14630498-14630520 ATGGGCAAAGAGGCTGGGCATGG - Intergenic
987491690 5:18588558-18588580 ATGTGCAAAGGGGCTGGGCACGG + Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
988267781 5:28973650-28973672 CTGGAGAACAGGCCTGGGAATGG - Intergenic
988834023 5:35014019-35014041 ATGGCTAAAGGGATTGGGAATGG - Exonic
988857890 5:35247000-35247022 ATGGGGGAAGGGGAGGGGAAGGG + Intergenic
988932693 5:36052515-36052537 ATGAAGCATGGGGTTGGGAAGGG - Intronic
988996340 5:36718304-36718326 CTGGAGTAGGGGACTGGGAAGGG - Intergenic
989710358 5:44389556-44389578 AGGGTGAAAGGGGCAGAGAAGGG + Intronic
989846910 5:46156441-46156463 ATGGGGTAAGGGGATGGGAGAGG - Intergenic
990304346 5:54480172-54480194 ATGGTGGAAGGGGAAGGGAAAGG - Intergenic
991017322 5:61945967-61945989 AGGAAGAGAGGGGCTGGGGAGGG + Intergenic
991341457 5:65615190-65615212 ATAGAGAAATAGGCTGGGCACGG - Intronic
992080432 5:73231010-73231032 ATTGAGAAGGGGGCTGGGGCGGG - Intergenic
992154016 5:73936856-73936878 ATGAACAAAGTGGCTGGGCATGG - Intronic
992180123 5:74187885-74187907 CTGGAGAAAGGGAGTGGGAGTGG + Intergenic
992272254 5:75077222-75077244 ATGGAAAAATTGGCTGGGCATGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992769132 5:80030794-80030816 ATGGATAAAGGGGCCAGGCATGG - Intronic
992846608 5:80755659-80755681 ATGGAAAAAGGAACTGGAAATGG + Intronic
993204557 5:84863213-84863235 ATGGAGAGAGAGGGAGGGAAGGG - Intergenic
993368864 5:87067217-87067239 ATAAAGATTGGGGCTGGGAAAGG - Intergenic
993618832 5:90144747-90144769 ATGGTGAAAGGAGCTTGGAAGGG - Intergenic
994325425 5:98440574-98440596 AAGAAGACAGGGGCTGGGCACGG + Intergenic
994551878 5:101244567-101244589 ATGGACAAAAGGGTTGAGAATGG + Intergenic
995131065 5:108631076-108631098 CTTGGGAAAGGGGCTGTGAAAGG - Intergenic
995154817 5:108898535-108898557 AGGGAGGAAGGGGAGGGGAAGGG - Intronic
995541992 5:113194686-113194708 AAGAAGAAAGGGGAAGGGAAAGG + Intronic
995543872 5:113210518-113210540 ATTGAGAAAGGGACTGAGAATGG + Intronic
995755879 5:115503343-115503365 ATGGAGAGAAGGGCTGGTAATGG + Intergenic
995856769 5:116600841-116600863 GTGGGGAATGGGGATGGGAAAGG + Intergenic
995857755 5:116611694-116611716 ATGGATGAGGGGGCTGGCAAGGG - Intergenic
995890245 5:116943024-116943046 GGAGAGAAAGGAGCTGGGAATGG + Intergenic
996506652 5:124275571-124275593 GTGGAGATGGGGGCTGGGAGTGG - Intergenic
996764344 5:127020693-127020715 ATGGAGAAATTAGCTGGGCATGG + Intronic
996825261 5:127675522-127675544 ATGGAGAACAGGCATGGGAATGG + Intergenic
996871406 5:128197524-128197546 ATGGAAAAAGGGCCGGTGAAAGG - Intergenic
997167257 5:131674422-131674444 ATGGAGAATAGGGCTGGGCATGG + Intronic
997466179 5:134089595-134089617 ATGCAGAAGGGAGCAGGGAAAGG - Intergenic
997512893 5:134465566-134465588 CGGGACATAGGGGCTGGGAAGGG + Intergenic
997725526 5:136117094-136117116 ATGGAGAGAAGAGGTGGGAAGGG + Intergenic
997782361 5:136672982-136673004 GTGGAAGAATGGGCTGGGAAGGG - Intergenic
997889828 5:137665857-137665879 AAGGGGAAAGGGGAAGGGAAAGG + Intronic
997901538 5:137770533-137770555 ATGGCTAAAGGGGCCGGGCATGG + Intergenic
997958813 5:138302767-138302789 ACAGAGAAAAGGGCTGGGTAGGG + Intronic
998762079 5:145443348-145443370 ATGGAGGGAGGTGATGGGAAAGG - Intergenic
999278996 5:150352364-150352386 GTGGAGAAGTGGGCAGGGAATGG + Intergenic
999414791 5:151385643-151385665 TTGGCAAAAGGGGCTGTGAAAGG - Intergenic
999426563 5:151492532-151492554 AAGAAGAAAGGGACTAGGAATGG + Intergenic
999440391 5:151595981-151596003 ATGAAGAAAGGGACAAGGAAGGG - Intergenic
999449014 5:151664748-151664770 ATGTGGAAAGGGACTGGGATTGG + Intronic
999584712 5:153077330-153077352 AGGGAAAAAGAGGATGGGAATGG + Intergenic
999737846 5:154526208-154526230 ATGGGGAAATGGGCTTTGAAGGG - Intergenic
999908384 5:156168913-156168935 ATGCAGAGAGTGCCTGGGAAGGG - Intronic
999931612 5:156439200-156439222 ATGGAAAAAGGGGTTGCAAAGGG - Intronic
1000027402 5:157371326-157371348 ATGGAGAAAGGAGCTGGAAATGG - Intronic
1000113872 5:158135215-158135237 CAGGAGAAAGGGGATGGGGAAGG + Intergenic
1000198652 5:158986122-158986144 AAGGAGACAGGGGCTGGGAGCGG - Intronic
1000287409 5:159838461-159838483 CTGGAAAAAGGGGCTTTGAAGGG + Intergenic
1000653223 5:163843598-163843620 GTGAAGAAAGGTGCTTGGAATGG + Intergenic
1000898762 5:166888651-166888673 ATGGAGAAAGGCACTAGGGAAGG + Intergenic
1001143285 5:169163030-169163052 ATTAAAAAAGGGGCTGGGCACGG + Intronic
1001216262 5:169858710-169858732 AGTGAGAGAGGGGCTGGGTACGG + Intronic
1001316057 5:170641975-170641997 TGGGAGAAAGGTGATGGGAAGGG - Intronic
1001608463 5:172981054-172981076 AGAAAGAAAGGGGCTGGGCATGG + Intergenic
1001651339 5:173318289-173318311 AGAGAGAGAGAGGCTGGGAATGG + Intronic
1002100216 5:176853861-176853883 ATGGACCAAGGGGACGGGAAGGG + Intronic
1002272757 5:178083554-178083576 ATGTAGAAAAGGGCTGATAAGGG + Intergenic
1002565946 5:180113082-180113104 ATGGACAGAGGGACTGGGGATGG + Intronic
1003321274 6:5054167-5054189 AGGAAGAAAAGGGGTGGGAAAGG + Intergenic
1003355255 6:5363214-5363236 ATGGGCAAAGGGGCTGGGCGAGG - Intronic
1003700544 6:8459945-8459967 AAGTAGAAAGAGGCTGGGCATGG - Intergenic
1003813043 6:9805586-9805608 ATGGTGAAGGGGGCTGGGTGTGG - Intronic
1004000621 6:11593806-11593828 AAGGAGAAATGGGCCGGGACTGG - Intergenic
1004324800 6:14665036-14665058 CTGGAGAAACAGGCTGGAAAGGG - Intergenic
1004570910 6:16844194-16844216 ATGGATGTAGGGGATGGGAAAGG - Intergenic
1004624477 6:17361989-17362011 AAGGAAGAAGGGGTTGGGAATGG - Intergenic
1004750199 6:18554711-18554733 AGGGATAGAGGGGCTGGCAATGG + Intergenic
1004835046 6:19521270-19521292 ATGGACTAGGGGGCTGGCAATGG + Intergenic
1004906443 6:20240815-20240837 ATTAAAAAAGGGGCTGGGCATGG + Intergenic
1004924237 6:20402990-20403012 ATGGAGAAGGGGGTGGGGGAGGG + Intronic
1005060697 6:21774502-21774524 AGGGAGAAAGGGAAGGGGAAGGG - Intergenic
1005399371 6:25415851-25415873 ATGGAGAAGGGGCTGGGGAATGG + Intronic
1005620727 6:27617773-27617795 AAGGGGAAAGGGGCCGGGAGGGG - Intergenic
1005711331 6:28505737-28505759 TTTGAGAAAGGGGATGTGAATGG - Exonic
1005714312 6:28532364-28532386 TTTGAGAAAGGGGATGTGAATGG + Exonic
1006175780 6:32120739-32120761 AAGGAGAAAAGGGCCGGGCATGG - Intronic
1006504285 6:34478041-34478063 AAGGATAAAGGGGCTGGGCATGG - Intronic
1007173095 6:39878307-39878329 ATGGAGTTATGGGCTGGGCAGGG - Intronic
1007379572 6:41479274-41479296 ATGGGGAAATGGGCAGTGAATGG - Intergenic
1007452709 6:41952324-41952346 GTGGAGAAATGAGCAGGGAAGGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007723906 6:43902697-43902719 ATGGAGTGAGGGGCTGGCAAGGG - Intergenic
1007754238 6:44088538-44088560 ATGAAGAAGGAGGCTGGGCACGG - Intergenic
1007766472 6:44163287-44163309 ATGGATAAAGGTGTTGGAAAAGG - Intronic
1007813300 6:44501922-44501944 AGGGAGAAAGGACCAGGGAATGG - Intergenic
1009912060 6:69942532-69942554 ATGGTTACTGGGGCTGGGAAGGG - Intronic
1010381670 6:75232517-75232539 ATCAAGAAATGGGCTGGGCACGG + Intergenic
1011172620 6:84522724-84522746 AGGGAGAAAGAGCCTGAGAATGG - Intergenic
1011527572 6:88281950-88281972 CTGGAGAAAGTGGAGGGGAAAGG - Intergenic
1012090217 6:94883445-94883467 GTGGAGAAAGGGGCAGAGAGGGG - Intergenic
1012153467 6:95785743-95785765 ATGGAGCAAGGGATTGTGAAGGG - Intergenic
1012244151 6:96907822-96907844 GTGGAGTTAGGGGCTGGCAAAGG - Intergenic
1012532040 6:100249928-100249950 TTGGAGAAAGGAGTGGGGAAAGG - Intergenic
1012586981 6:100935459-100935481 AGGGAGAAAGGGAGTGAGAAAGG - Intergenic
1012760753 6:103297594-103297616 AGGGAGAAAGGGGATGGTAATGG - Intergenic
1012872805 6:104692028-104692050 AGGGAGGAAGGGGAAGGGAAGGG + Intergenic
1013185871 6:107757429-107757451 ATGGAGAGTGTGGCTGGGGAAGG + Intronic
1013358167 6:109365385-109365407 GAGGAGAAAAGGGCTGGGGATGG + Intergenic
1013670454 6:112396696-112396718 AAGGAGAATGAGGTTGGGAAAGG - Intergenic
1013986184 6:116197099-116197121 ATGGAGAAAGGAGGTGGGGGTGG - Intronic
1014244994 6:119058491-119058513 AAGGAGAATTGGGCTGGGCACGG - Intronic
1015087463 6:129312574-129312596 AGGTAGAGAGGGGCTGGGTATGG - Intronic
1015158702 6:130126923-130126945 AAGGAGAATGGGGGTGGGATTGG + Intronic
1015209587 6:130682190-130682212 ATGAAGAAAGGGCCAGGGGAGGG - Intergenic
1015544611 6:134348619-134348641 TTGGAGAAAGGGCCTCAGAAGGG - Intergenic
1015698829 6:136012152-136012174 TTGTAGGCAGGGGCTGGGAAGGG - Intronic
1015959394 6:138631563-138631585 TTGGAGCTAGGGCCTGGGAAGGG - Intronic
1016462068 6:144287226-144287248 CTGGTAAAAGGGGCGGGGAATGG - Intronic
1016762506 6:147753714-147753736 ATGGTTACAGAGGCTGGGAAGGG - Intergenic
1016895666 6:149049796-149049818 TTAGAGAGAGGGGCTGGTAAAGG - Intronic
1017931952 6:158963490-158963512 AAAGAGAAAGAGACTGGGAAGGG - Intergenic
1018023260 6:159782973-159782995 ATGGAGAACAGGGCTGAAAAGGG + Intronic
1018107635 6:160504101-160504123 ATGGAGAACAGGCATGGGAATGG - Intergenic
1018534239 6:164802806-164802828 ATGGGGGAAGGGGCAGGGAACGG + Intergenic
1018740539 6:166725473-166725495 CTGGAGAAAGAGGCTGGGCTGGG - Intronic
1018746277 6:166764584-166764606 AAGGAGCAGGGGGTTGGGAAGGG + Intronic
1018747431 6:166773228-166773250 TTGGAGAAGGAGGCAGGGAAGGG + Intronic
1018923863 6:168193620-168193642 CTGGAGACAGGGTTTGGGAACGG + Intergenic
1018930807 6:168239287-168239309 AAGGAGAGAGGGGCTGGGCAGGG + Intergenic
1019075769 6:169387116-169387138 AAGGAGCCAGGGGCTGAGAACGG + Intergenic
1019389429 7:777558-777580 AGGGAGAAAGGGGATGGGGTGGG + Intronic
1019399579 7:844609-844631 AGTGTGAAAGGGGCCGGGAAAGG + Intronic
1019402969 7:866776-866798 AGGGAGAAGGGGGCGGGGAGGGG - Intronic
1019410965 7:906646-906668 AAGGAGAAAGGGGGCGGGAAAGG + Intronic
1019563966 7:1670651-1670673 AGGGAGAGAGGCGCTGGGGAAGG - Intergenic
1019701471 7:2476601-2476623 AGGGAGATATGGGCTGGGAAGGG - Intronic
1019779298 7:2930111-2930133 AAGGAGAAGGGGGCCGGGGAGGG + Intronic
1019832737 7:3349387-3349409 AAGGGGAATGGGGCTGGGGAGGG + Intronic
1020170146 7:5838738-5838760 ATTGAGAGAGGGGATGGGATGGG + Intergenic
1020174708 7:5872910-5872932 ATGGATGATGGGGCTGGGCACGG + Intergenic
1020453986 7:8351125-8351147 AAGAAGAATGGGGCTGGGAAAGG + Intergenic
1020745969 7:12078042-12078064 ATGTAAACAGGGGCTGGGCACGG - Intergenic
1020863890 7:13531629-13531651 ATAGAGAAAGGGGCTTGTAAAGG - Intergenic
1020941784 7:14548517-14548539 TTGGAGGAAGGAGATGGGAATGG + Intronic
1021220115 7:17965788-17965810 AAAAATAAAGGGGCTGGGAAAGG + Intergenic
1021289383 7:18823995-18824017 AAGGAGAAGGGGAATGGGAAGGG + Intronic
1021410387 7:20323564-20323586 TTGGAGAAGGGGGCTGAGAATGG + Intergenic
1021562261 7:21980228-21980250 ATGGAGAAAGAGGTGGTGAATGG + Intergenic
1022567243 7:31415827-31415849 ATGGGAAGAGGGGCTGGGCAAGG - Intergenic
1022847698 7:34227409-34227431 AGGGAGAAAGGGGCATGGGAAGG - Intergenic
1023040775 7:36171211-36171233 ATGAAGCATGGGGCTGGGCATGG - Intronic
1023175564 7:37432357-37432379 AGGGAGAAAGGGGATATGAAAGG + Intronic
1023243914 7:38179768-38179790 ATGGAGAAATGGGATGGTCAGGG + Intronic
1023410024 7:39881003-39881025 AGGGAAAAAGCAGCTGGGAACGG + Intergenic
1023528412 7:41129265-41129287 AAAGAGAAAGAGGTTGGGAAAGG - Intergenic
1023725395 7:43137838-43137860 AAGCAGAAAGTGGCTGGGCACGG - Intronic
1023882869 7:44330309-44330331 ATAGAGAAAGGGAGGGGGAATGG + Intronic
1023883540 7:44335097-44335119 ATGGGGGCAGGGACTGGGAAAGG - Intergenic
1025761865 7:64403198-64403220 CTGGAGAATGGGCATGGGAATGG + Intergenic
1026262491 7:68767079-68767101 ATGGAGAAAAGGGCCGGGCACGG - Intergenic
1026704491 7:72678452-72678474 ATGGAGAAATGGGCAAGGTATGG + Intronic
1026839946 7:73664805-73664827 ATGGTGAAAGGGGCCAGGCATGG + Intergenic
1027026739 7:74858210-74858232 ATGGGAAAAGGGGCTGGGCACGG + Intergenic
1027061013 7:75085899-75085921 ATGGGAAAAGGGGCTGGGCACGG - Intergenic
1027175894 7:75903247-75903269 CTGTGGAAAGGGGCTGGGCACGG + Intronic
1027205238 7:76092533-76092555 AAAGAGAAAAGGGCTGGGCATGG + Intergenic
1028366232 7:90036025-90036047 ATTGAGACTGGGGATGGGAATGG - Intergenic
1029084076 7:97997725-97997747 ATGGACGATGGGGCTGGGCACGG - Intergenic
1029261227 7:99304188-99304210 AAGGAGAAAGGGACTGAGAGGGG + Intergenic
1029375865 7:100176682-100176704 ATGAAGAATGGGGCTTGGAAGGG + Intronic
1029470422 7:100751031-100751053 AGTGAGAAAGGGGCCGGGATGGG + Intronic
1029475884 7:100784416-100784438 AAGGAAAAAGCGGCTGGGCATGG - Intronic
1029479163 7:100802517-100802539 AAGGAGAGTGGGGCTGGGTAGGG - Intergenic
1029575782 7:101402420-101402442 AAGGGGAAAGGGGAAGGGAAGGG - Intronic
1030014957 7:105209645-105209667 ATGGAGAAAGGGGAAAGCAAAGG + Intronic
1030359140 7:108577158-108577180 AAGTAGAAAGCGGCTGGGCATGG + Intergenic
1030614943 7:111729267-111729289 GAGGAGAAAGGAGCTGGGCATGG + Intronic
1030686061 7:112488114-112488136 CTGGAGAAAAGGGTTGGGACTGG + Intronic
1030797483 7:113806581-113806603 GTGGTGAAAGGGGGTGGGGAGGG - Intergenic
1031216544 7:118900097-118900119 ATTGAGTATGGGGCTGGGCATGG + Intergenic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031349241 7:120708664-120708686 ATTGGGAAAAGGGTTGGGAAGGG - Intronic
1031533873 7:122910191-122910213 AGGGAGAAAGGGGCTGGGCGCGG + Intergenic
1031557150 7:123191493-123191515 ATGGAGAAAGAGCTTGGGAAGGG + Intronic
1031922763 7:127613743-127613765 CTGGAGAAAGGTGCTGGGCTGGG - Exonic
1032130635 7:129224938-129224960 GCGGAGAAAGGGGGTGGGAGAGG + Intergenic
1032486026 7:132288070-132288092 TTGGAGGAGGGGGCTGGGAAAGG + Intronic
1032544531 7:132730711-132730733 ATGAAAGAAGGGGCTGGGCATGG + Intergenic
1032963762 7:137071688-137071710 ATGAAGCAAGAGGCTGGGCATGG + Intergenic
1033033990 7:137853892-137853914 ATGGAGAAAGGGAATGTGAATGG - Intergenic
1033270508 7:139928974-139928996 AAGGAGAAAGGGGGTTGGAGAGG + Intronic
1033449124 7:141447376-141447398 AAGGAGAAGGGGCCTGGGAGAGG + Intronic
1033804375 7:144937550-144937572 AAGGAGAAAGGGAAGGGGAAGGG - Intergenic
1033815808 7:145071053-145071075 ATGGCAAAAGGGGAAGGGAAAGG - Intergenic
1033905973 7:146203450-146203472 ATGAAGAGATGGGCAGGGAAGGG + Intronic
1034173998 7:149086335-149086357 AAGGTGAAGGGGGCTGGGCACGG + Intronic
1034528221 7:151679453-151679475 GTGGGGAAAGGGGCTGGGAGAGG - Intronic
1034599924 7:152241020-152241042 TTGGAGAAAGGCATTGGGAAAGG - Intronic
1034652094 7:152699776-152699798 ATTGAGAAAGAGGCTGGCACTGG - Intergenic
1034684468 7:152958130-152958152 AAAAAGAAAGGGGCTGGGAGGGG - Intergenic
1036077847 8:5521220-5521242 AAGGAAAAAGGGGCTGTGAATGG + Intergenic
1036114206 8:5940808-5940830 TTGGAGGATGGGGCTGGGAAAGG - Intergenic
1037339848 8:17832699-17832721 TTGGAGAGAGGGAATGGGAAAGG - Intergenic
1037542447 8:19885539-19885561 AGGGAGAAAGGAGAAGGGAAGGG - Intergenic
1037583608 8:20261540-20261562 ATGCAGAAGGGGGCTGGGGATGG - Intronic
1037754392 8:21701852-21701874 ATGGTGAAGGGGGCTGGGTGGGG + Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1037966232 8:23135819-23135841 AGGGACAAAGGAGCTGGGACCGG + Exonic
1038134994 8:24775758-24775780 ATGGACAAAGGGGCTGTGATAGG + Intergenic
1038420994 8:27433975-27433997 ATGGAATTAGGGGCTGGGATGGG + Intronic
1038484077 8:27921429-27921451 AGAGAGTATGGGGCTGGGAATGG + Intronic
1038518360 8:28206474-28206496 GTGGATAAAGGAGTTGGGAAGGG + Intergenic
1038545833 8:28425003-28425025 ATTCTGAAAGGGGCTGGGAATGG + Intronic
1038632666 8:29261364-29261386 ATGGGGAAAGGGAGAGGGAAAGG + Intronic
1038834060 8:31099106-31099128 AGGAAGGAAGGGGCTGGGAGTGG + Intronic
1039140385 8:34380946-34380968 ATGGAGCCAGGGGCTGGGTGTGG + Intergenic
1039331695 8:36544450-36544472 ATGGGCAAAGGGGCTGGGCATGG + Intergenic
1039345373 8:36698128-36698150 TAGGAGAAAGAGGCGGGGAAAGG + Intergenic
1039466776 8:37790195-37790217 TTGGACAAAGGGGATGGGGAAGG - Intronic
1039485218 8:37904548-37904570 GAGCAGAAAGGGGCTGGAAATGG + Intergenic
1040048155 8:42984075-42984097 AAGGACAAATGGGCTGGGCACGG + Intronic
1040607658 8:48950759-48950781 GTGGAGAAAAGGTCTGGGATGGG - Intergenic
1041985889 8:63922181-63922203 ATGGAGAACAGGTATGGGAATGG + Intergenic
1042234078 8:66590326-66590348 ATGTAAAAAGGGGCAAGGAATGG + Intronic
1042247678 8:66724268-66724290 AAGGAGAAATAGGCTGGGTATGG - Intronic
1042336533 8:67635475-67635497 AAAGAAAAAGGGGCTGGGCATGG + Intronic
1042713997 8:71751998-71752020 AAGGAGAAATGGGTTGGGAATGG - Intergenic
1042783979 8:72526117-72526139 ATGTTACAAGGGGCTGGGAAGGG - Intergenic
1042939446 8:74092357-74092379 AGGGAGAAAGGGTTTGGGAATGG + Intergenic
1043415909 8:80048930-80048952 ATGGACAAAGTGACTGTGAAAGG + Intronic
1044150512 8:88770825-88770847 ATGGAGAACAGGCATGGGAATGG + Intergenic
1044275254 8:90291844-90291866 ACCGAGAATGGGGCTGGGAGAGG - Intergenic
1044489878 8:92800800-92800822 ATGGAAAAAGGGGCTGGGCGCGG - Intergenic
1045072521 8:98523663-98523685 ATGGGCAAAGGGGCTGGGCATGG - Intronic
1045296007 8:100872159-100872181 CTGGAGAAGGGGGCTGGGGGTGG - Intergenic
1045423894 8:102043737-102043759 ATGGGGAAAGGGAAGGGGAAGGG + Intronic
1045578628 8:103453674-103453696 ACAGAGAAGAGGGCTGGGAATGG - Intergenic
1046687039 8:117239281-117239303 GAGGGGAAGGGGGCTGGGAAGGG - Intergenic
1047036337 8:120942845-120942867 TTGGAGAGGGGGGCTGGGCACGG - Intergenic
1047313318 8:123710354-123710376 AGGGAGGAAGGGGCTGCTAATGG + Intronic
1047475713 8:125226935-125226957 GTGGAGATAGGGGTTGGGGAAGG - Intronic
1047707909 8:127520160-127520182 AGAGAGAGAGGGGCAGGGAAAGG + Intergenic
1047863204 8:128991662-128991684 CTTGAGCAAGGGGCTGTGAAGGG + Intergenic
1047880170 8:129184262-129184284 ATGGAAAACAGGGCTGGGCATGG + Intergenic
1047908165 8:129495068-129495090 ATGAATCAAGGGGCTGGGAAGGG + Intergenic
1047947821 8:129900048-129900070 ACGGAGAAAGGGGATGACAAAGG + Intronic
1048176924 8:132161336-132161358 ATGAATAAAGGGGCTGGGCCCGG + Intronic
1048321829 8:133406035-133406057 TTGGAGAGAGGGGATGGGAGAGG - Intergenic
1048472809 8:134718581-134718603 ATGAAAAAAGGGGCAGGGAGTGG + Intergenic
1048654647 8:136522522-136522544 CTGGAGAACAGGGATGGGAATGG - Intergenic
1049204085 8:141355307-141355329 AGGGAGAAAGGGGCTTGCCAAGG - Intergenic
1049251855 8:141593445-141593467 ATGGAGGTACAGGCTGGGAAGGG + Intergenic
1049364470 8:142230327-142230349 AGGGAGCAAGGGACAGGGAATGG + Intronic
1049675652 8:143887715-143887737 TGGGAGGAAGGGGCTGGCAAGGG + Intergenic
1049829437 8:144690946-144690968 ATGGACAAAAGGGCTGGGCAAGG - Intergenic
1050035596 9:1432724-1432746 ATGAAAAAAGTGGCTGGGCACGG + Intergenic
1050060176 9:1700227-1700249 TTGGAGAAAGGATCTGGAAATGG + Intergenic
1050419721 9:5450696-5450718 ATGGAGAGAGGAGAAGGGAAAGG + Intronic
1050518735 9:6474413-6474435 AAGGAGAAATGGGCTGGGTGTGG + Intronic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051480415 9:17554030-17554052 AGAGAGAAAGGGGAGGGGAATGG - Intergenic
1051562893 9:18462646-18462668 AAGGAAAAAGGGGCCGGGCATGG + Intergenic
1051582598 9:18694175-18694197 TTGGAGGAGGGGGCTGGGGAAGG - Intronic
1052038425 9:23709424-23709446 ATGGAGAAGGTTGCTGGTAATGG - Intronic
1052151727 9:25125819-25125841 CTGGAGAACGGGCATGGGAATGG - Intergenic
1052790791 9:32873906-32873928 AAGGAGAAATGGGCTGTGCAGGG - Intergenic
1052967522 9:34352016-34352038 TTGAAAAAAGGGGCTGGGCATGG + Intergenic
1052976837 9:34417335-34417357 ATAAAGCTAGGGGCTGGGAATGG - Intronic
1053000469 9:34574780-34574802 ACGGTGCAAGAGGCTGGGAATGG - Intronic
1053292469 9:36890396-36890418 ATGGGGGAACTGGCTGGGAAAGG + Intronic
1053366785 9:37528482-37528504 ATGGAGATAGGGGTAGGGAGGGG - Intronic
1053429231 9:38031029-38031051 ATGAAGGAAAGGGCTGGGCATGG + Intronic
1054866950 9:70012728-70012750 AAGGAGAAAGGGGGAGGGCAGGG - Intergenic
1054961583 9:70975992-70976014 ATGGAGATAGGGGCTGGGGGAGG - Intronic
1055510398 9:76990629-76990651 CTGGAGAAAAGGGCAAGGAAAGG - Intergenic
1055559219 9:77505967-77505989 ATGTAAAAAGAGGCTGGGTATGG + Intronic
1055769749 9:79704401-79704423 CTTGGGAAAGGGGCTGGGCATGG - Intronic
1056066650 9:82942408-82942430 GAGGAGAAAGAGGATGGGAAGGG + Intergenic
1056451086 9:86717399-86717421 ATGGAGAAAGGAGCAGTGAGAGG - Intergenic
1056902917 9:90617243-90617265 AAGGAGAAAGGAGCTGTGATTGG + Intronic
1057722558 9:97544728-97544750 ATTGAAAGTGGGGCTGGGAACGG + Intronic
1057836790 9:98451770-98451792 CTGGATAAGGAGGCTGGGAAGGG - Intronic
1057842975 9:98501133-98501155 AAGGAGCAGGGGGCGGGGAAGGG - Intronic
1057851544 9:98570545-98570567 ATGGAGACAGAGCATGGGAAAGG - Intronic
1057852039 9:98573192-98573214 ATGAAGGAAGGGGTGGGGAAGGG + Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058420778 9:104831190-104831212 ATAGAAAAAGGGGCTTGGTAAGG - Intronic
1058854314 9:109045218-109045240 AGGGAGGTTGGGGCTGGGAAGGG - Intronic
1059352563 9:113676048-113676070 GTGGAGAAATAGGCTGGGCATGG + Intergenic
1059375669 9:113879149-113879171 AAGGAGAGATGGGCTGGGGAGGG + Intronic
1059661470 9:116406072-116406094 TTGGATATAGGGGCTGGGCACGG - Intergenic
1060339585 9:122762230-122762252 ATGAAGAAATGGACTTGGAAAGG + Intergenic
1060354716 9:122894587-122894609 ATGAAGAGAGAGGCTGGGCACGG + Intronic
1060421707 9:123473770-123473792 GTGGAGAAAGAGACTGGGATGGG - Intronic
1060601580 9:124881696-124881718 AGAGAGAAAGGGGCTGGGCAGGG + Intronic
1060737657 9:126076695-126076717 ATGGAAAAAGGAGTGGGGAAAGG + Intergenic
1060793462 9:126500399-126500421 GTGCAGAAAGGAGCTGGGGAAGG - Intronic
1060895231 9:127212785-127212807 GTGGAGGATGGGGGTGGGAAAGG + Intronic
1061315134 9:129790707-129790729 ATGGAAAGAAGGCCTGGGAAAGG - Intergenic
1061458880 9:130720273-130720295 ATAGAGAAGGGGACAGGGAATGG + Intronic
1061691800 9:132339051-132339073 ATTGGGAAAAGGGCTGGGCATGG - Intronic
1061885291 9:133588184-133588206 CAGCAGAAAGGGGCTGGGACTGG - Intergenic
1062082329 9:134630601-134630623 CTGGAGGAATGGGCTGGGAGGGG + Intergenic
1062480942 9:136751034-136751056 AGGGAGAAATGGGAGGGGAAGGG + Intergenic
1062527691 9:136984959-136984981 AGGGAGAGAGGGGCAGGGAGGGG - Exonic
1203584616 Un_KI270746v1:53521-53543 TTAGAGAAAGGCACTGGGAAAGG - Intergenic
1185504597 X:621915-621937 GTGGAGTAGGGGGCGGGGAAGGG + Intergenic
1185617551 X:1432537-1432559 AGGGAGAAAGGGGCCGGGCGCGG + Intronic
1187078501 X:15960979-15961001 AGGGAGAATGGGGTTGGGAATGG + Intergenic
1187305107 X:18087898-18087920 ATGGAGAAGGGGGTGAGGAATGG - Intergenic
1187326891 X:18299221-18299243 GTGGACAAAGGGGCTGGGCAAGG + Intronic
1187758562 X:22553649-22553671 CAGGAGAAAGAGGCTGGGAAGGG + Intergenic
1187788411 X:22919909-22919931 CTGGAAAAAGGGATTGGGAAGGG + Intergenic
1188029209 X:25245716-25245738 ATGAAGAGAGAGGCTGGGCATGG - Intergenic
1188114161 X:26223341-26223363 ATGGTGGCAGGGGCTGGTAATGG - Intergenic
1188153086 X:26703703-26703725 ATGGAGGTAGAGGGTGGGAAAGG + Intergenic
1189169703 X:38897370-38897392 ATGCAGAAAGGGTCTGGTATTGG - Intergenic
1189848787 X:45159001-45159023 ATGGAGAGGGGGGCAGGGCAGGG - Intronic
1190329235 X:49225691-49225713 ATAAAGAAAGGTGCTGAGAAAGG + Intronic
1190417978 X:50199811-50199833 GGGGAGAAAGGGGGAGGGAATGG - Intronic
1192180264 X:68911952-68911974 ATGGGGAAAGGGTCTGGGGTTGG - Intergenic
1192214599 X:69149998-69150020 ATGGAGGAGGGCGCTGTGAATGG + Intergenic
1192224980 X:69221765-69221787 ATGGAGGAGGGCGCTGTGAATGG - Intergenic
1192268241 X:69555324-69555346 ATAGAGAATGTGGCTGGGGATGG + Intergenic
1192440585 X:71170751-71170773 AAGGAGAAAGGGGCTAGCACTGG + Intronic
1192561849 X:72132430-72132452 CTGAAAAAAGGGGCTGGGGATGG - Intergenic
1192631400 X:72780498-72780520 ATGGGGAAAGGGTTTTGGAAGGG + Intronic
1192650309 X:72940303-72940325 ATGGGGAAAGGGTTTTGGAAGGG - Intronic
1192661857 X:73050059-73050081 CTGGAGAAAAGGCATGGGAATGG - Intergenic
1192678435 X:73225290-73225312 ATGGAGAACAGGGATGGGAAAGG + Intergenic
1192731280 X:73804806-73804828 ATGGAAAAAGGAGTGGGGAAAGG + Intergenic
1193108896 X:77707452-77707474 ATGGGCAAAGGGGCTGGGCACGG + Intronic
1193221764 X:78934970-78934992 ATGGAGGAAGGGGCTGCGGGAGG + Intergenic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1193809099 X:86030491-86030513 ATGGGGAAAGGGGAGAGGAAGGG + Intronic
1194015787 X:88619032-88619054 ATGAACAAAGGGGCTGGGTGTGG + Intergenic
1194773278 X:97930921-97930943 ATGGAGAAAGGGCCTTGTCAGGG - Intergenic
1194833645 X:98656495-98656517 CTGGAGAACGGGAATGGGAATGG + Intergenic
1194980599 X:100436331-100436353 ATGGAAATGGGGGGTGGGAAAGG + Intergenic
1194984778 X:100478530-100478552 AAGGATAAAGAGGCTGGGGAGGG - Intergenic
1195068752 X:101260184-101260206 ATGGAGAAAGGGGCTGGGAAAGG - Intronic
1195119481 X:101736024-101736046 ATTTAGAAAGAGGCTGGGCATGG - Intergenic
1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG + Intergenic
1195780299 X:108455089-108455111 ATGGAGGATGGGGGTAGGAAGGG - Intronic
1196069975 X:111509656-111509678 ATTGTGAAAGGGAGTGGGAAGGG - Intergenic
1196070480 X:111515797-111515819 AAAGGGAAAGGGTCTGGGAAAGG + Intergenic
1196702956 X:118691569-118691591 ATGGGCTAAGGGGCTGGGAACGG - Intergenic
1196731717 X:118947582-118947604 ATGGAGAATCAGGCTGGGCATGG + Intergenic
1197097177 X:122610540-122610562 ATGGAGAACAGGCATGGGAATGG + Intergenic
1197497762 X:127207273-127207295 CTGGAGAACAGGCCTGGGAATGG - Intergenic
1197767160 X:130066767-130066789 GGGGAGAAAGGGGCTGGGGTGGG + Exonic
1197829917 X:130630582-130630604 ATAGAGCAAGGTACTGGGAAGGG - Intronic
1197985075 X:132258278-132258300 TTGGACATAGGGGCAGGGAATGG + Intergenic
1198050812 X:132951605-132951627 ATGTAGACAGGTGCTGGGAGAGG - Intronic
1198323687 X:135545073-135545095 ATGGAGTAAGGGGCAGAGGAAGG - Intronic
1198546863 X:137701585-137701607 AGGGGGAAATTGGCTGGGAAAGG + Intergenic
1198634378 X:138679367-138679389 ATGGAGTATGGGGCTGGGTGTGG - Intronic
1199066324 X:143422804-143422826 ATGGGCAAAAGGGCTGGGCATGG - Intergenic
1199157755 X:144570823-144570845 ATGGAAAAATTTGCTGGGAAAGG - Intergenic
1199460982 X:148084600-148084622 ATGGAGAGAGGAGCTGCCAAGGG - Intergenic
1199573023 X:149287212-149287234 ATGTAAACAGGGGCTGGAAAGGG - Intergenic
1199766754 X:150946942-150946964 ATGGAGGAATGGGGTGGGGAGGG + Intergenic
1199802855 X:151268566-151268588 ATGAAGAGAGGGGCTGAGAATGG + Intergenic
1199830173 X:151541647-151541669 ATGGAGACAAGGGCTGGGGGAGG - Intergenic
1200103480 X:153700024-153700046 AGGCAGAAAGGGGCTGGGAATGG - Intergenic
1200170794 X:154072815-154072837 AGAGACAAAGGGGCTGGGCATGG + Intronic
1200234524 X:154461847-154461869 AAGGAGGAACGAGCTGGGAACGG - Intronic
1201452960 Y:14136116-14136138 AGGGAGGGAGGGGATGGGAATGG - Intergenic
1201458235 Y:14194354-14194376 AGGTGGAAAGGGGATGGGAAAGG - Intergenic
1201598295 Y:15696915-15696937 ATGGAGAAAAGAGTTTGGAATGG - Intergenic