ID: 1195071719

View in Genome Browser
Species Human (GRCh38)
Location X:101287609-101287631
Sequence CAGTACTACCAGAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195071719 Original CRISPR CAGTACTACCAGAAGTGGTC AGG (reversed) Intronic
902418124 1:16254814-16254836 CAGTATGGCCAGAAGTGGACAGG + Intronic
913116245 1:115700278-115700300 CAGTACTCCCACAATTGGCCAGG - Exonic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
917930836 1:179821491-179821513 TCCTACTACCAGAAGTGGGCAGG + Intergenic
918885250 1:190184725-190184747 GAGTACTACTAGAAGTGGGAAGG + Intronic
918979050 1:191531130-191531152 CAGTATTAAAAGAAGTGGGCTGG + Intergenic
919252646 1:195078041-195078063 AAGTACTTCCTGAAGTGCTCTGG + Intergenic
1066550912 10:36555770-36555792 CTGTAAAACCAGAAGAGGTCAGG + Intergenic
1068087686 10:52395213-52395235 CAATACCACCAGAAGAGATCAGG - Intergenic
1068721672 10:60252784-60252806 AAGTACATCCAGAAGTAGTCAGG - Intronic
1088796839 11:113272326-113272348 CATTACAACCACAACTGGTCTGG - Intronic
1094523571 12:31217725-31217747 CAGAACTCCCACAAGTGGGCAGG + Intergenic
1106033212 13:26020930-26020952 CAGGACTCCCAGCCGTGGTCAGG + Exonic
1115905910 14:38202711-38202733 CAGAACTACCAGGAGTGGTCCGG - Intergenic
1116259077 14:42599710-42599732 AAGTAATACCATATGTGGTCAGG + Intergenic
1116434338 14:44879349-44879371 CTGTACTACAAGAAATGGTAAGG + Intergenic
1118590947 14:67400543-67400565 CAGCACTAGCAGGACTGGTCTGG + Intronic
1118610538 14:67536121-67536143 CAATACCAAAAGAAGTGGTCAGG - Intronic
1118901131 14:69986888-69986910 CTGTAGGAGCAGAAGTGGTCGGG - Intronic
1120168538 14:81225762-81225784 CAGCACTACCAGCTGAGGTCAGG + Intergenic
1130931941 15:88435767-88435789 CAGGATTAACAGATGTGGTCGGG - Intergenic
1142782159 17:2189771-2189793 CAGTACTTTCAGAAGTGGGTTGG - Intronic
1144729535 17:17518545-17518567 CAGTGCATCCAGAGGTGGTCAGG - Intronic
1155994907 18:32320847-32320869 CAGAATTACCAGAAGTTTTCTGG + Intronic
1158859685 18:61580343-61580365 CAGAAGGACCAGAAGTGGCCAGG + Intergenic
1160629858 18:80239245-80239267 CAGCTGTACCAGAAGTGCTCTGG + Intronic
929283203 2:40105863-40105885 CTGAATTACCAGATGTGGTCAGG - Intronic
931658369 2:64531328-64531350 CACTCCTACCAGCAGTGGTTGGG + Intronic
932154002 2:69398914-69398936 CAGAATTACCTGAGGTGGTCAGG + Intronic
933151460 2:78919983-78920005 CAGTACAGACAGACGTGGTCAGG - Intergenic
934937459 2:98475780-98475802 CAGTACTACCCATAGTGGGCAGG + Intronic
941423531 2:165314487-165314509 CAGTATCACCAGAGGTGGTAAGG + Intronic
942262568 2:174183847-174183869 TAATACTACCAGAAATGTTCAGG + Intronic
943857612 2:192818362-192818384 AACTATTACCAGAAGTGATCTGG + Intergenic
1169408034 20:5341949-5341971 CAGTACTACCCAAGGTGGTCTGG + Intergenic
1169947005 20:10999777-10999799 CAGAACTGGCAGAAGTGGACAGG - Intergenic
1172388876 20:34552723-34552745 CAGTTCTGCAAGATGTGGTCGGG + Intronic
1173176646 20:40769954-40769976 CAGTAGTCCCAGAAGGGGTGAGG - Intergenic
1174822566 20:53739724-53739746 CAGTGCTACAATAAGTAGTCTGG + Intergenic
953395002 3:42561897-42561919 CCGTACTATCAGAAGTGGTAAGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968430358 4:554845-554867 CAGTGCTACCAGAATTGCCCAGG - Intergenic
971232002 4:24807622-24807644 CAGGACTCCCAGTGGTGGTCTGG - Exonic
975720752 4:77246555-77246577 CAGAAGTTCCAGAAGTGGTGGGG - Intronic
977016653 4:91699954-91699976 CAGCACTACCAGCTGTGGTGGGG + Intergenic
979893658 4:126131920-126131942 CAGCACTACCAGCTGTGGTGGGG - Intergenic
984060910 4:174988326-174988348 CAGCACTACCAGTTGTGGTGGGG + Intergenic
987237436 5:15957244-15957266 CAGTGCTATCTGCAGTGGTCAGG - Intergenic
989145248 5:38243031-38243053 AGGTGCTACCAGGAGTGGTCGGG - Intergenic
989742577 5:44790076-44790098 CAGCACTACCAGTTGTGGTGGGG - Intergenic
990109553 5:52306518-52306540 CAGCACTACCAGCTGTGGTGGGG - Intergenic
991157469 5:63456153-63456175 CAGTAATACAAGAAGTGGGGTGG - Intergenic
995738217 5:115326255-115326277 CAGTCCTCCCAGCAGTGGTCTGG - Intergenic
998429173 5:142055635-142055657 CATTTCTACCAGCAGTGTTCAGG - Intergenic
1007669795 6:43542206-43542228 CAGTACTTTCAGAATTGGTCTGG - Intronic
1014996612 6:128153529-128153551 CTGTACTATCAGAAGGTGTCTGG + Intronic
1022441067 7:30433690-30433712 CCTTAGAACCAGAAGTGGTCTGG + Intronic
1023453041 7:40308583-40308605 CAGTAGTACAAGATGAGGTCAGG - Intronic
1026524146 7:71140068-71140090 CATTAATGCCAGAGGTGGTCTGG + Intronic
1028644021 7:93075465-93075487 CAGTGCTACCAGTAATGATCAGG - Intergenic
1029024349 7:97400172-97400194 CAGCACGACCAGAAGAGGTAAGG + Intergenic
1029818340 7:103120515-103120537 CAGTACTGCCAGAAGTAGACTGG + Intronic
1035411333 7:158645059-158645081 CAGTACTACTTGAACTGGTTGGG + Intronic
1038828947 8:31035313-31035335 CAGTTTTACAATAAGTGGTCAGG + Intronic
1039691821 8:39872427-39872449 CAGCACTACCAGCTGTGGTGGGG - Intergenic
1042613411 8:70622562-70622584 AAGTTTTACCAGAAGTGTTCTGG - Intronic
1042804386 8:72756015-72756037 CATGACTACCAGAAAAGGTCTGG + Intronic
1048102314 8:131366885-131366907 CAGTACTCTCAGAAGTTGACAGG - Intergenic
1052741569 9:32398039-32398061 CAGAACTATCAGTAGTGGGCTGG - Intronic
1191029757 X:55956512-55956534 CAGTCCTACCAGCAGTGCACAGG + Intergenic
1192687554 X:73323084-73323106 CAGCACTACCAGCTGTGGTGGGG + Intergenic
1194592983 X:95822945-95822967 AAGTACTACAATAAGTTGTCAGG + Intergenic
1195071719 X:101287609-101287631 CAGTACTACCAGAAGTGGTCAGG - Intronic
1198069137 X:133130578-133130600 CAGTACTTCCAGCAGTGGGAAGG - Intergenic
1201370179 Y:13254568-13254590 CAGTACTACCAGCTGTGGCGGGG - Intronic
1201796913 Y:17905888-17905910 CAGGACTATCAGCAGTGGGCTGG + Intergenic
1201804640 Y:18000097-18000119 CAGGACTATCAGCAGTGGGCTGG - Intergenic
1202358288 Y:24074947-24074969 CAGGACTATCAGCAGTGGGCTGG + Intergenic
1202512490 Y:25595166-25595188 CAGGACTATCAGCAGTGGGCTGG - Intergenic