ID: 1195072561

View in Genome Browser
Species Human (GRCh38)
Location X:101294232-101294254
Sequence CTCCCTGAGACACTTTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195072561_1195072564 -5 Left 1195072561 X:101294232-101294254 CCTGACAAAAGTGTCTCAGGGAG No data
Right 1195072564 X:101294250-101294272 GGGAGCATCTCTGTGGGTAGAGG No data
1195072561_1195072565 -2 Left 1195072561 X:101294232-101294254 CCTGACAAAAGTGTCTCAGGGAG No data
Right 1195072565 X:101294253-101294275 AGCATCTCTGTGGGTAGAGGAGG No data
1195072561_1195072567 0 Left 1195072561 X:101294232-101294254 CCTGACAAAAGTGTCTCAGGGAG No data
Right 1195072567 X:101294255-101294277 CATCTCTGTGGGTAGAGGAGGGG No data
1195072561_1195072566 -1 Left 1195072561 X:101294232-101294254 CCTGACAAAAGTGTCTCAGGGAG No data
Right 1195072566 X:101294254-101294276 GCATCTCTGTGGGTAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195072561 Original CRISPR CTCCCTGAGACACTTTTGTC AGG (reversed) Intergenic
No off target data available for this crispr