ID: 1195073539

View in Genome Browser
Species Human (GRCh38)
Location X:101304530-101304552
Sequence CCCCAGTGTGGGGCAATGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195073539_1195073555 15 Left 1195073539 X:101304530-101304552 CCGAGCATTGCCCCACACTGGGG No data
Right 1195073555 X:101304568-101304590 AGGGAATATCCTGCCTGTGTGGG No data
1195073539_1195073550 -5 Left 1195073539 X:101304530-101304552 CCGAGCATTGCCCCACACTGGGG No data
Right 1195073550 X:101304548-101304570 TGGGGGGCTGGGGGTCCCAAAGG No data
1195073539_1195073556 19 Left 1195073539 X:101304530-101304552 CCGAGCATTGCCCCACACTGGGG No data
Right 1195073556 X:101304572-101304594 AATATCCTGCCTGTGTGGGAAGG No data
1195073539_1195073554 14 Left 1195073539 X:101304530-101304552 CCGAGCATTGCCCCACACTGGGG No data
Right 1195073554 X:101304567-101304589 AAGGGAATATCCTGCCTGTGTGG No data
1195073539_1195073560 29 Left 1195073539 X:101304530-101304552 CCGAGCATTGCCCCACACTGGGG No data
Right 1195073560 X:101304582-101304604 CTGTGTGGGAAGGTTGGCTAAGG No data
1195073539_1195073557 23 Left 1195073539 X:101304530-101304552 CCGAGCATTGCCCCACACTGGGG No data
Right 1195073557 X:101304576-101304598 TCCTGCCTGTGTGGGAAGGTTGG No data
1195073539_1195073551 -4 Left 1195073539 X:101304530-101304552 CCGAGCATTGCCCCACACTGGGG No data
Right 1195073551 X:101304549-101304571 GGGGGGCTGGGGGTCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195073539 Original CRISPR CCCCAGTGTGGGGCAATGCT CGG (reversed) Intergenic
No off target data available for this crispr