ID: 1195073547

View in Genome Browser
Species Human (GRCh38)
Location X:101304540-101304562
Sequence ACCCCCAGCCCCCCAGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195073547_1195073555 5 Left 1195073547 X:101304540-101304562 CCCCACACTGGGGGGCTGGGGGT No data
Right 1195073555 X:101304568-101304590 AGGGAATATCCTGCCTGTGTGGG No data
1195073547_1195073560 19 Left 1195073547 X:101304540-101304562 CCCCACACTGGGGGGCTGGGGGT No data
Right 1195073560 X:101304582-101304604 CTGTGTGGGAAGGTTGGCTAAGG No data
1195073547_1195073556 9 Left 1195073547 X:101304540-101304562 CCCCACACTGGGGGGCTGGGGGT No data
Right 1195073556 X:101304572-101304594 AATATCCTGCCTGTGTGGGAAGG No data
1195073547_1195073561 26 Left 1195073547 X:101304540-101304562 CCCCACACTGGGGGGCTGGGGGT No data
Right 1195073561 X:101304589-101304611 GGAAGGTTGGCTAAGGTTAGTGG No data
1195073547_1195073554 4 Left 1195073547 X:101304540-101304562 CCCCACACTGGGGGGCTGGGGGT No data
Right 1195073554 X:101304567-101304589 AAGGGAATATCCTGCCTGTGTGG No data
1195073547_1195073557 13 Left 1195073547 X:101304540-101304562 CCCCACACTGGGGGGCTGGGGGT No data
Right 1195073557 X:101304576-101304598 TCCTGCCTGTGTGGGAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195073547 Original CRISPR ACCCCCAGCCCCCCAGTGTG GGG (reversed) Intergenic
No off target data available for this crispr