ID: 1195073549

View in Genome Browser
Species Human (GRCh38)
Location X:101304542-101304564
Sequence GGACCCCCAGCCCCCCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195073549_1195073561 24 Left 1195073549 X:101304542-101304564 CCACACTGGGGGGCTGGGGGTCC No data
Right 1195073561 X:101304589-101304611 GGAAGGTTGGCTAAGGTTAGTGG No data
1195073549_1195073560 17 Left 1195073549 X:101304542-101304564 CCACACTGGGGGGCTGGGGGTCC No data
Right 1195073560 X:101304582-101304604 CTGTGTGGGAAGGTTGGCTAAGG No data
1195073549_1195073557 11 Left 1195073549 X:101304542-101304564 CCACACTGGGGGGCTGGGGGTCC No data
Right 1195073557 X:101304576-101304598 TCCTGCCTGTGTGGGAAGGTTGG No data
1195073549_1195073555 3 Left 1195073549 X:101304542-101304564 CCACACTGGGGGGCTGGGGGTCC No data
Right 1195073555 X:101304568-101304590 AGGGAATATCCTGCCTGTGTGGG No data
1195073549_1195073556 7 Left 1195073549 X:101304542-101304564 CCACACTGGGGGGCTGGGGGTCC No data
Right 1195073556 X:101304572-101304594 AATATCCTGCCTGTGTGGGAAGG No data
1195073549_1195073554 2 Left 1195073549 X:101304542-101304564 CCACACTGGGGGGCTGGGGGTCC No data
Right 1195073554 X:101304567-101304589 AAGGGAATATCCTGCCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195073549 Original CRISPR GGACCCCCAGCCCCCCAGTG TGG (reversed) Intergenic