ID: 1195073552

View in Genome Browser
Species Human (GRCh38)
Location X:101304563-101304585
Sequence ACAGGCAGGATATTCCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195073552_1195073563 18 Left 1195073552 X:101304563-101304585 CCCAAAGGGAATATCCTGCCTGT No data
Right 1195073563 X:101304604-101304626 GTTAGTGGCCAGAGGACCCTTGG No data
1195073552_1195073562 10 Left 1195073552 X:101304563-101304585 CCCAAAGGGAATATCCTGCCTGT No data
Right 1195073562 X:101304596-101304618 TGGCTAAGGTTAGTGGCCAGAGG No data
1195073552_1195073561 3 Left 1195073552 X:101304563-101304585 CCCAAAGGGAATATCCTGCCTGT No data
Right 1195073561 X:101304589-101304611 GGAAGGTTGGCTAAGGTTAGTGG No data
1195073552_1195073560 -4 Left 1195073552 X:101304563-101304585 CCCAAAGGGAATATCCTGCCTGT No data
Right 1195073560 X:101304582-101304604 CTGTGTGGGAAGGTTGGCTAAGG No data
1195073552_1195073557 -10 Left 1195073552 X:101304563-101304585 CCCAAAGGGAATATCCTGCCTGT No data
Right 1195073557 X:101304576-101304598 TCCTGCCTGTGTGGGAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195073552 Original CRISPR ACAGGCAGGATATTCCCTTT GGG (reversed) Intergenic
No off target data available for this crispr