ID: 1195073553

View in Genome Browser
Species Human (GRCh38)
Location X:101304564-101304586
Sequence CACAGGCAGGATATTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195073553_1195073560 -5 Left 1195073553 X:101304564-101304586 CCAAAGGGAATATCCTGCCTGTG No data
Right 1195073560 X:101304582-101304604 CTGTGTGGGAAGGTTGGCTAAGG No data
1195073553_1195073562 9 Left 1195073553 X:101304564-101304586 CCAAAGGGAATATCCTGCCTGTG No data
Right 1195073562 X:101304596-101304618 TGGCTAAGGTTAGTGGCCAGAGG No data
1195073553_1195073561 2 Left 1195073553 X:101304564-101304586 CCAAAGGGAATATCCTGCCTGTG No data
Right 1195073561 X:101304589-101304611 GGAAGGTTGGCTAAGGTTAGTGG No data
1195073553_1195073563 17 Left 1195073553 X:101304564-101304586 CCAAAGGGAATATCCTGCCTGTG No data
Right 1195073563 X:101304604-101304626 GTTAGTGGCCAGAGGACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195073553 Original CRISPR CACAGGCAGGATATTCCCTT TGG (reversed) Intergenic
No off target data available for this crispr