ID: 1195073554

View in Genome Browser
Species Human (GRCh38)
Location X:101304567-101304589
Sequence AAGGGAATATCCTGCCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195073548_1195073554 3 Left 1195073548 X:101304541-101304563 CCCACACTGGGGGGCTGGGGGTC No data
Right 1195073554 X:101304567-101304589 AAGGGAATATCCTGCCTGTGTGG No data
1195073549_1195073554 2 Left 1195073549 X:101304542-101304564 CCACACTGGGGGGCTGGGGGTCC No data
Right 1195073554 X:101304567-101304589 AAGGGAATATCCTGCCTGTGTGG No data
1195073539_1195073554 14 Left 1195073539 X:101304530-101304552 CCGAGCATTGCCCCACACTGGGG No data
Right 1195073554 X:101304567-101304589 AAGGGAATATCCTGCCTGTGTGG No data
1195073547_1195073554 4 Left 1195073547 X:101304540-101304562 CCCCACACTGGGGGGCTGGGGGT No data
Right 1195073554 X:101304567-101304589 AAGGGAATATCCTGCCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195073554 Original CRISPR AAGGGAATATCCTGCCTGTG TGG Intergenic
No off target data available for this crispr