ID: 1195073561

View in Genome Browser
Species Human (GRCh38)
Location X:101304589-101304611
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195073547_1195073561 26 Left 1195073547 X:101304540-101304562 CCCCACACTGGGGGGCTGGGGGT No data
Right 1195073561 X:101304589-101304611 GGAAGGTTGGCTAAGGTTAGTGG No data
1195073552_1195073561 3 Left 1195073552 X:101304563-101304585 CCCAAAGGGAATATCCTGCCTGT No data
Right 1195073561 X:101304589-101304611 GGAAGGTTGGCTAAGGTTAGTGG No data
1195073549_1195073561 24 Left 1195073549 X:101304542-101304564 CCACACTGGGGGGCTGGGGGTCC No data
Right 1195073561 X:101304589-101304611 GGAAGGTTGGCTAAGGTTAGTGG No data
1195073553_1195073561 2 Left 1195073553 X:101304564-101304586 CCAAAGGGAATATCCTGCCTGTG No data
Right 1195073561 X:101304589-101304611 GGAAGGTTGGCTAAGGTTAGTGG No data
1195073548_1195073561 25 Left 1195073548 X:101304541-101304563 CCCACACTGGGGGGCTGGGGGTC No data
Right 1195073561 X:101304589-101304611 GGAAGGTTGGCTAAGGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195073561 Original CRISPR GGAAGGTTGGCTAAGGTTAG TGG Intergenic