ID: 1195078397

View in Genome Browser
Species Human (GRCh38)
Location X:101348767-101348789
Sequence GAGTGCACTGCGTCGGCGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 24}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195078385_1195078397 26 Left 1195078385 X:101348718-101348740 CCGCGACGGAACCGGAACCACAG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1195078397 X:101348767-101348789 GAGTGCACTGCGTCGGCGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 24
1195078386_1195078397 15 Left 1195078386 X:101348729-101348751 CCGGAACCACAGCTAGCTGCCTC 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1195078397 X:101348767-101348789 GAGTGCACTGCGTCGGCGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 24
1195078389_1195078397 9 Left 1195078389 X:101348735-101348757 CCACAGCTAGCTGCCTCTGGGAC 0: 1
1: 0
2: 2
3: 19
4: 198
Right 1195078397 X:101348767-101348789 GAGTGCACTGCGTCGGCGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 24
1195078390_1195078397 -4 Left 1195078390 X:101348748-101348770 CCTCTGGGACCGCCCCCGTGAGT 0: 1
1: 0
2: 1
3: 5
4: 55
Right 1195078397 X:101348767-101348789 GAGTGCACTGCGTCGGCGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195078397 Original CRISPR GAGTGCACTGCGTCGGCGCG AGG Exonic
900460984 1:2802022-2802044 GAGTGCACTGGGTGGGCAGGCGG - Intergenic
1067561951 10:47310407-47310429 AAGTGCTGTGCGTGGGCGCGCGG - Exonic
1076688883 10:132210794-132210816 GAGGGCACTGCCTCGGGGTGGGG - Intronic
1084086294 11:66856867-66856889 GAGTGCGCTGCGGCAGCGCCGGG + Intronic
1095536941 12:43260616-43260638 GACTGCACTGCGGCCGGGCGCGG + Intergenic
1110706236 13:78603557-78603579 GAGTGCATCCCGTCGGCGCGCGG - Exonic
1114553625 14:23548844-23548866 GAGAGCACTGCGGGGGCGCCGGG - Intronic
1123094587 14:105760879-105760901 GAGTGCACTGGGTGGGTGCTGGG + Intergenic
1160631013 18:80246709-80246731 GCGTGCTCTGGGTCTGCGCGGGG + Intronic
1163426832 19:17244907-17244929 GGGTGCACGGCGGCGGCGCGCGG + Intronic
1167978737 19:53254895-53254917 GAGTGCACTGGGGCGGCGCAAGG + Intronic
925385294 2:3457968-3457990 GAGTGGTCTGAGTGGGCGCGAGG + Intronic
943725151 2:191245389-191245411 GAGTGCTCAGCGGCGGCGGGAGG - Exonic
1173864847 20:46307390-46307412 GAGTGGACTGCGTGGGCGCGCGG - Intronic
1176414516 21:6467199-6467221 GGGTCCACTCCGCCGGCGCGGGG + Intergenic
1179690014 21:43075521-43075543 GGGTCCACTCCGCCGGCGCGGGG + Intronic
1180985989 22:19904163-19904185 GAGTGCACTGGGGTGGGGCGGGG - Intronic
952764722 3:36944525-36944547 GACAGGACTGCGGCGGCGCGCGG - Intronic
968661798 4:1801746-1801768 GAGGGCCCTGGGGCGGCGCGGGG + Intronic
973293359 4:48490817-48490839 GAGTACACGGCGACGGTGCGCGG - Exonic
983229205 4:165112722-165112744 GAGTGCACGGAGGCGGCGGGCGG - Intronic
992365484 5:76084831-76084853 GGGAGGACTGCGGCGGCGCGGGG + Intronic
1001496109 5:172188457-172188479 GAGTGCCCTGCGGCGACGGGCGG - Intergenic
1003330099 6:5122620-5122642 GAAAGCACTGGGTCGGCGAGAGG - Intronic
1018021137 6:159762799-159762821 GAGGGCACTGCCTCCTCGCGTGG + Intronic
1036801397 8:11795040-11795062 GAGCCCACGGCGGCGGCGCGGGG - Intergenic
1049025905 8:139988686-139988708 GGGTGGCCTGCGGCGGCGCGAGG + Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1195078397 X:101348767-101348789 GAGTGCACTGCGTCGGCGCGAGG + Exonic
1198727460 X:139692242-139692264 GAGTGCCCAGCGGCGGCGCGCGG - Intronic