ID: 1195078442

View in Genome Browser
Species Human (GRCh38)
Location X:101348946-101348968
Sequence TCTCAACGGCACCTCGGCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195078442_1195078447 10 Left 1195078442 X:101348946-101348968 CCAGAGCCGAGGTGCCGTTGAGA 0: 1
1: 0
2: 1
3: 3
4: 55
Right 1195078447 X:101348979-101349001 AAAAGAAAAGAAAGGAGAAAAGG 0: 1
1: 40
2: 524
3: 3032
4: 15372
1195078442_1195078445 2 Left 1195078442 X:101348946-101348968 CCAGAGCCGAGGTGCCGTTGAGA 0: 1
1: 0
2: 1
3: 3
4: 55
Right 1195078445 X:101348971-101348993 TTACTCCAAAAAGAAAAGAAAGG 0: 1
1: 0
2: 6
3: 106
4: 1173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195078442 Original CRISPR TCTCAACGGCACCTCGGCTC TGG (reversed) Exonic
901602141 1:10430655-10430677 TCTCATCGGCACCCCGCCCCCGG + Intronic
904772053 1:32886217-32886239 TCTCCTCGGCACCTCGGCTCTGG - Intronic
1064927505 10:20585346-20585368 TCTCAACTACAGCTCAGCTCCGG + Intergenic
1076356408 10:129856933-129856955 TCTAAACGGCACTCCGGCCCTGG - Intronic
1086426514 11:86689088-86689110 TCTCTATGGGACCTCAGCTCTGG + Intergenic
1087994172 11:104782819-104782841 TCCCAACTGCACCACAGCTCAGG - Intergenic
1088756158 11:112887048-112887070 TCTCAACTTCACCAAGGCTCAGG - Intergenic
1091225782 11:133956003-133956025 TCTCAGCCGCACCTGGGCCCCGG - Intronic
1091231045 11:133988290-133988312 TCTCGCCAGCACCTGGGCTCTGG + Intergenic
1091286433 11:134411211-134411233 TCCCATCTGCACCTGGGCTCAGG - Intronic
1091351489 11:134901130-134901152 TCTCAACAGAACCTGGGCTGTGG - Intergenic
1102519030 12:113467718-113467740 TCGCCTCGGCCCCTCGGCTCCGG + Intronic
1119468204 14:74876240-74876262 TCTCAACGCCACCCCAACTCAGG + Intergenic
1131150648 15:90045515-90045537 TCCCAGCGGCCCCTGGGCTCAGG - Intronic
1131559125 15:93424238-93424260 TCTCCACGGCACCTTTTCTCTGG - Intergenic
1132724770 16:1333902-1333924 TCTCGACGTCCCCTCGGCCCTGG + Intronic
1150640360 17:66945543-66945565 TCTCAGCGCCACCTGGGATCGGG + Intergenic
1152571135 17:81121759-81121781 TCTCCAGGGTACCCCGGCTCGGG + Exonic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1165072087 19:33261470-33261492 TCTCACAGGCTCCTGGGCTCAGG - Intergenic
1167701191 19:51047043-51047065 TATCAACACCACCTCGACTCAGG - Intergenic
940301011 2:152176223-152176245 TCTCAAAGCCACCTCCGCGCCGG - Intergenic
948652160 2:239454782-239454804 TCTCAATGGGCCCTGGGCTCCGG + Intergenic
1171518711 20:25759566-25759588 TCTCCCCGGGACCTCTGCTCAGG - Intergenic
1176216215 20:63949181-63949203 ACTCAGCCTCACCTCGGCTCCGG + Intronic
1176652860 21:9565971-9565993 TCTCCCCGGGACCTCTGCTCAGG - Intergenic
1180114832 21:45695424-45695446 TCTCACAGGCACCTCAGCACTGG + Intronic
1182123804 22:27802196-27802218 TGTCTACTGCACTTCGGCTCCGG + Intergenic
1185373626 22:50472018-50472040 TCTCAAAGACACCTCAGCACTGG + Intronic
949541085 3:5032624-5032646 TCTCAACTGCATCTCATCTCAGG - Intergenic
950113361 3:10434778-10434800 CCTCAAGGGCACCTCGGCCTGGG - Intronic
954754022 3:52829312-52829334 TTTCAATGCCACCTCAGCTCGGG + Intronic
955303836 3:57809759-57809781 TCTCAACGTCTGCTCAGCTCTGG - Intronic
957665463 3:83219062-83219084 TCTCTGCGGCACCTCGGTGCCGG - Intergenic
967000152 3:185326380-185326402 TCTCCAGGGCACCTCTGCCCTGG + Intronic
968055050 3:195684898-195684920 CCTCAACCTCCCCTCGGCTCAGG + Intergenic
968100850 3:195964319-195964341 CCTCAACCTCCCCTCGGCTCAGG - Intergenic
974828778 4:67163423-67163445 TCTCAAATGCACCTCTGCTGTGG - Intergenic
985628407 5:1002103-1002125 TCACAAAGCGACCTCGGCTCAGG - Intergenic
1015492137 6:133838135-133838157 TCTCAACGGCACCTGGCCCCCGG - Intergenic
1021334143 7:19377793-19377815 TCTCAATGGATCCTCTGCTCTGG - Intergenic
1024677923 7:51654620-51654642 TCCCAACAGCACCTCGGATCAGG - Intergenic
1025279206 7:57614683-57614705 TCTCCCCGGGACCTCTGCTCAGG - Intergenic
1025305525 7:57850817-57850839 TCTCCCCGGGACCTCTGCTCAGG + Intergenic
1030176125 7:106656447-106656469 TCACAGGGGCACCTCGGGTCAGG + Intergenic
1040898157 8:52389793-52389815 TCTCTACTGCCCCTCGGCTCCGG - Intronic
1048730316 8:137433019-137433041 TCTCAAGCCCACCTTGGCTCAGG + Intergenic
1049692179 8:143966259-143966281 TCTCATAGGCACCTAAGCTCTGG + Intronic
1056251562 9:84753626-84753648 TCTCAACTGCACCCAGGCCCAGG + Intronic
1056381012 9:86057506-86057528 CCTCAGCTGCACCCCGGCTCGGG - Intronic
1056569040 9:87799745-87799767 TCTCCACCGCAGCTCCGCTCAGG - Intergenic
1061458638 9:130717937-130717959 TCTCAATGCAACCTCCGCTCCGG - Intronic
1203630589 Un_KI270750v1:69512-69534 TCTCCCCGGGACCTCTGCTCAGG - Intergenic
1189255679 X:39637112-39637134 TCTGAAAAGCACCTCTGCTCTGG - Intergenic
1190691449 X:52916399-52916421 TCCCGACGGCACCTGGGCTGTGG - Intergenic
1190694534 X:52939393-52939415 TCCCGACGGCACCTGGGCTGTGG + Intronic
1193565252 X:83067925-83067947 TCTCCATGGCACCTCAGCTGAGG + Intergenic
1195078442 X:101348946-101348968 TCTCAACGGCACCTCGGCTCTGG - Exonic
1200210544 X:154345027-154345049 TCGGGCCGGCACCTCGGCTCAGG - Intergenic
1200220308 X:154387065-154387087 TCGGGCCGGCACCTCGGCTCAGG + Intergenic