ID: 1195080890

View in Genome Browser
Species Human (GRCh38)
Location X:101369183-101369205
Sequence TTGTGGATAAATATTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195080890 Original CRISPR TTGTGGATAAATATTTCCCA AGG (reversed) Intronic
900543546 1:3216173-3216195 ATGTGGAAACATTTTTCCCATGG - Intronic
901978563 1:13015032-13015054 TTGATGATAAATATTTCCACTGG - Intronic
902003519 1:13213906-13213928 TTGATGATAAATATTTCCACTGG + Intergenic
902022747 1:13359645-13359667 TTGATGATAAATATTTCCACTGG + Intergenic
904636486 1:31885424-31885446 TTGTTTAAAAATACTTCCCATGG + Intergenic
906837755 1:49102206-49102228 TTGTGGATCCAAAATTCCCATGG + Intronic
906840514 1:49133715-49133737 CTGAGGATAAATATTTAGCAGGG - Intronic
906858448 1:49332595-49332617 TTGTGGAATAATATTTCACAGGG + Intronic
907639480 1:56171807-56171829 ATGTGGATAAATATTAACTATGG - Intergenic
909372981 1:74908160-74908182 TTGTATATAAATATTTCTCTTGG + Intergenic
909477209 1:76094341-76094363 GTGTGGATTTATATATCCCAAGG + Intronic
910378937 1:86604765-86604787 TTTTGCATCAATATTTACCAGGG + Intergenic
910934824 1:92479216-92479238 GTGTGGATATGTATTTGCCATGG - Intronic
911320839 1:96411690-96411712 TTTTTGTTACATATTTCCCAAGG + Intergenic
918092365 1:181308452-181308474 ATGTAGATAAACCTTTCCCAGGG - Intergenic
919018473 1:192072268-192072290 TTTTGGATAACTATTTCTGATGG - Intergenic
921913240 1:220575845-220575867 TTCTGGAGAAATAATACCCATGG - Intronic
923774077 1:236962670-236962692 GTGTGGTTAATTATTTCCAATGG + Intergenic
923959461 1:239060552-239060574 TTATGGATAAATATTTCTCTTGG + Intergenic
1064155844 10:12902385-12902407 TTGTGGATAGATATTAGCTATGG + Intronic
1064724703 10:18266928-18266950 CTGTGCAAATATATTTCCCAAGG - Intronic
1066600734 10:37103901-37103923 TTATGGATAAATAATACCCTAGG + Intergenic
1066601466 10:37112333-37112355 TTATGGATAAATAATACCCTAGG - Intergenic
1067091844 10:43270806-43270828 TGGTGCCTAAACATTTCCCAAGG - Intergenic
1068377429 10:56199465-56199487 TTTTGAATAAATCTTTCTCAGGG - Intergenic
1072495626 10:95955644-95955666 TTGTGTAAAAATATTTCACAGGG + Intronic
1073422359 10:103434593-103434615 TGGTGGACAACTCTTTCCCAGGG - Intronic
1076162832 10:128258838-128258860 TTGGTGAAAAATATTCCCCAAGG + Intergenic
1081293433 11:41354933-41354955 TTGTTGTGAAATCTTTCCCAAGG - Intronic
1082197992 11:49326381-49326403 TTGTAGATGAATCTTTCTCATGG + Intergenic
1088770143 11:113026625-113026647 GTGTGGATAAATATTTTGTATGG + Intronic
1089107177 11:116022183-116022205 TTTTGGATATAAATTTCCCCAGG + Intergenic
1090671211 11:128946825-128946847 TTATGGTTAAACATTTACCAGGG - Intergenic
1092010624 12:5108644-5108666 TTATGGATAAGTATATTCCATGG - Intergenic
1092580104 12:9831322-9831344 TTTTAGATAAATAGTTCGCAGGG - Intronic
1093658841 12:21729870-21729892 TTATGGATTCATATTTCCTAAGG + Intronic
1093861645 12:24173857-24173879 TTGTGGATCATCATTTTCCACGG - Intergenic
1093916877 12:24813139-24813161 TTGTGGGTAAATAATTTCCTGGG - Intronic
1096561815 12:52440919-52440941 TTGGGTCTAAACATTTCCCAGGG + Intergenic
1098048015 12:66422148-66422170 TTGTGCATAAACATTTTCCTGGG - Intronic
1098131103 12:67351406-67351428 TTGTAGATCAATATTTCTCAGGG + Intergenic
1098334135 12:69384410-69384432 TTATTGATAAAAACTTCCCAAGG - Intronic
1098991870 12:77072510-77072532 TTGTCCATTAATATTTCCCTCGG - Intergenic
1102073113 12:110037875-110037897 TTGTAGATAAATTTTTATCAAGG + Exonic
1104275765 12:127326141-127326163 TTGTGGATTATTCTTTCCTAGGG + Intergenic
1105036886 12:132931189-132931211 TTTTAAATAAATATTTCCCAGGG + Intronic
1105565999 13:21548870-21548892 TTCTGAATAAAAACTTCCCAGGG + Intronic
1106785410 13:33103181-33103203 TTGTAAATAAATAATTGCCAAGG - Exonic
1106902003 13:34363453-34363475 TTGCGGATGAATATTCCCTATGG + Intergenic
1109392125 13:61707055-61707077 TTGAGGATAATTAGATCCCAGGG + Intergenic
1109744249 13:66600996-66601018 TCATAAATAAATATTTCCCAGGG + Intronic
1109969390 13:69746166-69746188 TTATTTATAAATATTTCACAAGG - Intronic
1112038143 13:95516904-95516926 GTATGGGTAAATATTGCCCATGG - Intronic
1112655233 13:101445318-101445340 GTGTGGATAAAGATATCCCCAGG - Intergenic
1113452402 13:110420483-110420505 TTGTGGAAATATTTTTCTCAAGG + Intronic
1114848427 14:26352586-26352608 TTATTCATAAATTTTTCCCAAGG + Intergenic
1115451879 14:33557295-33557317 TTGCTGCGAAATATTTCCCATGG - Intronic
1115473086 14:33788760-33788782 CTGTGGACAAAGTTTTCCCAAGG + Intronic
1116123123 14:40746549-40746571 TTGTGGAGAAATATTATTCAAGG - Intergenic
1116442799 14:44973751-44973773 TTGTGAAAGATTATTTCCCAGGG + Intronic
1116933903 14:50717633-50717655 TTGTGGAAGACAATTTCCCATGG + Intergenic
1117311869 14:54534036-54534058 TTGTGGGTAAATATTTGATATGG - Intronic
1117638338 14:57770860-57770882 TTGGGTATAAATCCTTCCCATGG - Intronic
1118120209 14:62831252-62831274 GTTTGGATAGGTATTTCCCAAGG + Intronic
1118894979 14:69938384-69938406 GAGTGGATAAATATTTTCTAAGG + Intronic
1119446821 14:74671874-74671896 TTGTGGATAAATATGTCTAGTGG - Intronic
1119880268 14:78094187-78094209 TTGTGGCTAATTTTTTCCCTTGG + Intergenic
1121017739 14:90558627-90558649 TTGTGGAAAAAAATTTTCCAAGG - Intronic
1121853125 14:97241539-97241561 TCATGGATAGATTTTTCCCATGG - Intergenic
1124127822 15:26953561-26953583 TTGGGAATAAAACTTTCCCATGG - Intergenic
1125265323 15:37872825-37872847 TTGTTGATAAATCTTTCCATTGG - Intergenic
1127664917 15:61136207-61136229 TTGTGGACAAATCTTTCAGATGG - Intronic
1131526738 15:93158757-93158779 TTGAAGAATAATATTTCCCAGGG + Intergenic
1136276921 16:29184348-29184370 TTTTGTATAAATATTTCGAAGGG + Intergenic
1136774154 16:32862683-32862705 GTGTGGATTAATATTTTGCAAGG + Intergenic
1136896457 16:33998831-33998853 GTGTGGATTAATATTTTGCAAGG - Intergenic
1138059238 16:53872258-53872280 GTATGAATAAAAATTTCCCAAGG - Intronic
1141515058 16:84538299-84538321 TCGTGGGTAATTATCTCCCAGGG - Intronic
1142081295 16:88150413-88150435 TTTTGTATAAATATTTCGAAGGG + Intergenic
1203076578 16_KI270728v1_random:1124802-1124824 GTGTGGATTAATATTTTGCAAGG + Intergenic
1143162289 17:4879555-4879577 CTGAGGATAAAAATTACCCATGG + Intronic
1144646294 17:16976254-16976276 CTGTTGATCAATATTTCCCAGGG + Intergenic
1146659532 17:34655258-34655280 ATGTGGAAAAACATTTCCCGGGG - Intergenic
1150303286 17:64063827-64063849 TTGGGGGTAAAAATGTCCCAAGG + Intronic
1150850217 17:68697016-68697038 TGGTGGATAAACAGGTCCCAGGG + Intergenic
1152712113 17:81876934-81876956 TTGGTGGTAAATGTTTCCCAAGG + Intergenic
1153261587 18:3229499-3229521 TTCTGGGCAAATACTTCCCAAGG - Intergenic
1153746564 18:8185655-8185677 TTGTTAATAGATGTTTCCCAGGG + Intronic
1157617268 18:48994695-48994717 TTGTGTAGAAATAGTTCCCAGGG + Intergenic
1159285981 18:66352413-66352435 TTGAGGATGAAAATTTCCTAGGG + Intergenic
1159900004 18:74036926-74036948 TTGTGGAAAAAATTTTTCCACGG + Intergenic
1161740410 19:6017833-6017855 GAGTGGACAGATATTTCCCAGGG - Intronic
1161760597 19:6168265-6168287 GTGTGGAAAAATACTTCCCACGG - Intronic
1162077870 19:8200649-8200671 TCGTGGATAACTATTGCCAAAGG - Intronic
1165287709 19:34856233-34856255 ATATGGAGAAATATTTCCCTAGG - Intergenic
925978547 2:9157959-9157981 TTGTGCTTAAATTTTTCCAAGGG - Intergenic
928534497 2:32227008-32227030 GTGTGGCTAAATTTTTGCCAAGG + Intronic
929018780 2:37529294-37529316 TTTTGGAAAATTGTTTCCCATGG + Intergenic
929070540 2:38025872-38025894 TTTTGCATAAATATTTACAACGG + Intronic
929131600 2:38580119-38580141 TTGTGGTTACATTTTTCTCAGGG - Intronic
929738495 2:44577061-44577083 TTCTGGTTAAATAATTCCCCAGG + Intronic
930294744 2:49540988-49541010 TTTTGCATCAATATTTACCAGGG - Intergenic
930436130 2:51344697-51344719 TGGTGGTTAAATATATCACAAGG + Intergenic
930933097 2:56913463-56913485 ATGGTGATAAATATTTTCCAGGG + Intergenic
930950152 2:57131552-57131574 GTGTGTATATATATTTCTCATGG + Intergenic
931379941 2:61743357-61743379 TTGTGGGTAATTATTTTCCATGG + Intergenic
931533107 2:63239526-63239548 TTGTGAATAGAGATTTCCTAGGG + Intronic
935469963 2:103447066-103447088 TTCTGGATAAATATTTCATTTGG - Intergenic
935901714 2:107799764-107799786 TGGTGCATAAATACTTCCCTTGG - Intergenic
936703066 2:115037040-115037062 TTGTTGACAAATAGCTCCCATGG - Intronic
938736767 2:134192782-134192804 TTGTGGTAAAATATTTATCATGG + Intronic
939431046 2:142108316-142108338 TTTTGGATTGCTATTTCCCATGG - Intronic
939899281 2:147830549-147830571 TTGTTGCTAAATATTTCTCATGG + Intergenic
940246033 2:151617127-151617149 TTATGAATAAATATTTCCATAGG - Intronic
940579765 2:155563644-155563666 TTGTAGATAAATGTTTCTAATGG - Intergenic
943001436 2:182332869-182332891 TGATGGAGAAATATTTACCAAGG + Intronic
943135274 2:183902917-183902939 CTGTAAATAAATATTTTCCAGGG - Intergenic
943521207 2:188951012-188951034 ATGTGGATAAATAGTACTCATGG - Intergenic
943858615 2:192830171-192830193 ATATGGATAAATATTTCAAATGG - Intergenic
945347413 2:208734374-208734396 TTGAGCATAATTCTTTCCCAAGG + Intronic
948008797 2:234634037-234634059 CTCTGTATAAATATTTCCCCAGG + Intergenic
948745989 2:240095025-240095047 TTGTTGAAAAACATTTCACAAGG - Intergenic
1169114873 20:3057746-3057768 TGAAGGAGAAATATTTCCCAAGG + Intergenic
1169307530 20:4505244-4505266 TTAGGGATAAATATTTGCCCTGG - Intergenic
1170112473 20:12820850-12820872 TTGTGGGTAAATATTTCATTTGG - Intergenic
1173919771 20:46734954-46734976 ATGGGGATAATTATGTCCCAGGG + Exonic
1174374122 20:50114089-50114111 ATTTGCAAAAATATTTCCCAAGG - Intronic
1174995405 20:55561827-55561849 TTAGTCATAAATATTTCCCAAGG + Intergenic
1175655892 20:60770443-60770465 ATGTGGTTTAATATTTCCCTAGG + Intergenic
1178636457 21:34308155-34308177 TTGTGGAGAGAAATTTCCCTAGG + Intergenic
1182151832 22:28032990-28033012 TTGTTGAGTAATATTTACCAGGG - Intronic
1182155317 22:28066634-28066656 TTTTGGTTAAATATTCCACAAGG - Intronic
949210242 3:1490551-1490573 TTGTGTATAATTAATTACCAGGG + Intergenic
950863122 3:16168234-16168256 TGGTGGATAAATATTTCAGTAGG - Intergenic
951337968 3:21447200-21447222 TTTTGGATAAATATTACGAAAGG + Intronic
951377934 3:21945616-21945638 TTGAAGATAAACATTTACCATGG - Intronic
956153167 3:66264686-66264708 TTGTGGAAGAAAATTTTCCATGG - Intronic
956268165 3:67421532-67421554 TTGTGCAGAAATGTTTCTCAAGG - Intronic
957503235 3:81085119-81085141 TTCTAAATAATTATTTCCCAAGG + Intergenic
957853930 3:85848767-85848789 TTATGGATAAATATTTCCTTTGG + Intronic
961115504 3:124325808-124325830 TTGTAGAAAAAGATTTCCCTTGG + Intronic
961942760 3:130655214-130655236 TTTGGGTTAAATCTTTCCCACGG + Intronic
962477283 3:135766223-135766245 TTGTGGATATATACTTTCCTAGG - Intergenic
963693518 3:148535466-148535488 ATGGGGATAAATTTCTCCCAAGG + Intergenic
965846713 3:172970746-172970768 CTGTGGAAAAATTTTTCACATGG + Intronic
966553994 3:181237870-181237892 TTGTGGATATCTAATTCCCATGG + Intergenic
966951126 3:184818847-184818869 TTAGGAATAAATGTTTCCCAAGG + Intronic
967791742 3:193557231-193557253 TTGTGGAAAATAATTTTCCATGG - Intronic
972055178 4:34793262-34793284 TTGTGAGTACATATTTTCCATGG + Intergenic
972344818 4:38183786-38183808 GTGTGGAAAGATATTTACCATGG + Intergenic
972831523 4:42819585-42819607 CTGTGGATAAATATTAAACATGG + Intergenic
974817213 4:67020807-67020829 CTGTGAACAAATGTTTCCCAGGG + Intergenic
975261819 4:72311772-72311794 TTTTGGTTAAATATGTCCAATGG - Intronic
976621783 4:87135725-87135747 ATGTGCAAAAATAGTTCCCAAGG - Exonic
977085333 4:92589546-92589568 GAATGGATAAATATTTCTCAAGG - Intronic
978612187 4:110554892-110554914 TATTGAATAAATATTTCTCAAGG + Intronic
978988513 4:115047332-115047354 TTGTTGATAAATACTTTTCAAGG + Intronic
979061966 4:116074316-116074338 TTAGAGATAAATATTTCTCATGG - Intergenic
979098997 4:116591149-116591171 GTGTGTATATATATATCCCATGG + Intergenic
979428788 4:120601288-120601310 TTATAGAGACATATTTCCCACGG - Intergenic
979535608 4:121816919-121816941 TTGTGAATAAAAAATACCCAGGG - Exonic
979870730 4:125817178-125817200 TTTTATATATATATTTCCCAAGG - Intergenic
982029235 4:151282495-151282517 TTGTTGAAAAATATTTTCCATGG - Intronic
982369295 4:154616853-154616875 TTGTGTATAAAAATAGCCCAGGG + Intergenic
982600896 4:157446857-157446879 TTCTGTATGAATATTTTCCAAGG - Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
983980402 4:173988914-173988936 TTGGGGAAAAACATTTCCCCAGG + Intergenic
985215963 4:187654667-187654689 ATGTGGTTAATTATTTCCAAAGG - Intergenic
987137680 5:14914985-14915007 TTATGGATACACATTTGCCAAGG - Intergenic
988444154 5:31266270-31266292 TTGAAAATTAATATTTCCCATGG + Intronic
989268654 5:39506215-39506237 TTGTAGATGAATATTACCCAAGG + Intergenic
989561373 5:42855918-42855940 CTGTGGTTAAAAATTGCCCAGGG + Intronic
989659307 5:43781706-43781728 TTGTGCATATATATATGCCATGG + Intergenic
990153862 5:52851892-52851914 TTATGTATAAATATTTCCCATGG - Intronic
990613786 5:57486492-57486514 TTGTGGTTAAATACTGCCTAAGG + Intergenic
990698667 5:58451702-58451724 GTGTTGATAAATCTTTGCCATGG - Intergenic
991321436 5:65377656-65377678 GTGTTGATAAATTTTTTCCAGGG + Intronic
991613518 5:68472370-68472392 TGATGGATAAATATTTCTCTAGG + Intergenic
993745315 5:91589933-91589955 TTGTGGAAAAGAATTCCCCATGG - Intergenic
994003992 5:94816291-94816313 TTATGGATACACACTTCCCATGG - Intronic
994794025 5:104270516-104270538 TTGTTTATAAATATTTCTCTTGG + Intergenic
998327627 5:141295759-141295781 TTGAGGATGAATATTTTTCAGGG - Intergenic
1000408198 5:160911082-160911104 TTGGGGAGAAATGTTTCCAATGG + Intergenic
1000607275 5:163338489-163338511 TTGAGGATAGATTTTTACCATGG - Intergenic
1000807746 5:165817753-165817775 TTGTGGATAATTAATGTCCAGGG + Intergenic
1000826431 5:166050728-166050750 GTGTGGATTTATATATCCCAAGG - Intergenic
1001626312 5:173138051-173138073 TTGTGGAATACCATTTCCCATGG + Exonic
1005095843 6:22114700-22114722 TTATGGATAAAGATTTGGCAAGG - Intergenic
1008326077 6:50183832-50183854 TTTTGGAAAACTGTTTCCCAGGG - Intergenic
1009749916 6:67869739-67869761 TTGAGGATAAATTTTTACAATGG + Intergenic
1012537871 6:100321298-100321320 TAGTCAATAATTATTTCCCAAGG + Intergenic
1012769426 6:103410661-103410683 TTGTGAATAAATATTTTTTAAGG + Intergenic
1014050633 6:116949517-116949539 TTGTTGATAATGATTTTCCAGGG + Intergenic
1014582852 6:123160184-123160206 TTGTGGATAAATATTTGAAAGGG + Intergenic
1014954887 6:127602400-127602422 TTGTGTATAGACATTTCACATGG - Intergenic
1015338959 6:132075395-132075417 TTTAGTATAAATATGTCCCACGG - Intergenic
1015675542 6:135743409-135743431 TTCTCGATAAATGTTTACCAAGG - Intergenic
1016579180 6:145609409-145609431 TTGTGAGTAAAAATTTCACATGG + Intronic
1017219833 6:151953189-151953211 TTGGGGATAAATAGCTTCCAGGG - Intronic
1017349306 6:153420826-153420848 TCAAGGAAAAATATTTCCCATGG - Intergenic
1018496521 6:164352667-164352689 TTGTGCATAAATAATACCAAAGG - Intergenic
1019808496 7:3146808-3146830 TTGAGCATAAAGATTTCCCCTGG - Intronic
1020934844 7:14450057-14450079 TTTTGGATAAATTGTTCCCTGGG + Intronic
1021318062 7:19175450-19175472 TTGTGGCTAAATATTTCAACAGG + Intergenic
1023221723 7:37926103-37926125 CTGTGGATGATTAATTCCCAGGG + Intronic
1024351404 7:48368647-48368669 TTATGGATGAGTATATCCCATGG + Intronic
1024995929 7:55273221-55273243 CTCTGGGTAAATATCTCCCAGGG + Intergenic
1027477083 7:78646572-78646594 TTGTAGAAAAATATTTGCAAAGG - Intronic
1027683486 7:81251084-81251106 TCCTGGAAAAATATTCCCCATGG + Intergenic
1030109907 7:106018214-106018236 ATGTGGATCTTTATTTCCCAGGG - Intronic
1030618004 7:111758537-111758559 TTCTGAGTAAATATTTACCAAGG + Intronic
1031426121 7:121607835-121607857 TTGTGCCTAAATAATTCCAAAGG - Intergenic
1033249088 7:139743383-139743405 TTGTATATAAAAATGTCCCAAGG - Intronic
1033448463 7:141441848-141441870 TTGTTGCTAATTCTTTCCCAGGG - Intronic
1033605080 7:142921128-142921150 GTGTGGACAAATAGATCCCACGG + Intronic
1037172733 8:15912867-15912889 TTTTGGATCAAAATTTCGCATGG + Intergenic
1037532007 8:19785979-19786001 TGGAGGAAAAACATTTCCCAGGG + Intergenic
1038102731 8:24396991-24397013 CTATGGAAAAATATTTACCACGG + Intronic
1039653296 8:39368294-39368316 ATTTTAATAAATATTTCCCATGG - Intergenic
1041587777 8:59541954-59541976 ATGAGCATAAATATTTGCCAAGG - Intergenic
1041640324 8:60192874-60192896 TTATGTATAAATTTTTCCTATGG + Intronic
1042023659 8:64399662-64399684 TAGTGGAAAAATAATTCCCAGGG - Intergenic
1044342607 8:91064572-91064594 CGGTGGATAAATATTTCCAGTGG + Intergenic
1045700427 8:104860528-104860550 TTGTGAAAAAATATCTCACATGG - Intronic
1046391808 8:113583493-113583515 TGGTGTATAAAAATTTCCGAGGG + Intergenic
1046392639 8:113596179-113596201 TTGTTGATAAATATTTTAAATGG - Intergenic
1048141503 8:131799307-131799329 TTCTTCATAAAAATTTCCCAAGG - Intergenic
1048160066 8:132010560-132010582 TTGTATATACATATTTTCCAAGG + Intronic
1048822850 8:138395617-138395639 TGGTTGATAAATATTTTGCATGG - Intronic
1050856938 9:10370514-10370536 TTCTACATAAATGTTTCCCAAGG - Intronic
1051849639 9:21491318-21491340 ATGTGGAGAAATATCTCCCTGGG + Intergenic
1059135319 9:111800960-111800982 TTTAGGGTAAATATTACCCAGGG - Intergenic
1059495064 9:114702655-114702677 CTGTGGAAAGAGATTTCCCACGG + Intergenic
1059606994 9:115844385-115844407 TTGTAGGTAGATATTTCTCACGG + Intergenic
1203360590 Un_KI270442v1:217226-217248 TTGTGGATCAATAGTCCCCGGGG - Intergenic
1185554678 X:1011171-1011193 TTCTGTAAAAATATTTCCCGCGG + Intergenic
1185870423 X:3660170-3660192 TGGTGGGGAAATATTTTCCAAGG + Intronic
1186010369 X:5125106-5125128 TTGTCAATAAATCTTTCCCCAGG + Intergenic
1186822670 X:13306679-13306701 TTGTGGATAATTATTTGTTATGG - Intergenic
1186937659 X:14468335-14468357 TTGTGGAAAAATGTTGCCCATGG + Intergenic
1188295848 X:28447219-28447241 TTTTGGAGAAATCTTTGCCAGGG - Intergenic
1193398038 X:81009371-81009393 GTATGGAGAAATATTTACCAAGG - Intergenic
1193747846 X:85304264-85304286 TGTAGGATAAATACTTCCCATGG - Intronic
1194000517 X:88422915-88422937 ATGTATATAAATATTTTCCATGG - Intergenic
1194806647 X:98337489-98337511 TTTTCGATCTATATTTCCCAAGG + Intergenic
1194838337 X:98709614-98709636 TTTTGCATCAATATTTACCAAGG + Intergenic
1195080890 X:101369183-101369205 TTGTGGATAAATATTTCCCAAGG - Intronic
1195292941 X:103446606-103446628 CAGAGGATAAAAATTTCCCAGGG + Intergenic
1197318381 X:124996858-124996880 TAGTTGATAAATGTTTCACATGG - Intergenic
1198071431 X:133152157-133152179 TACTGGAGAAATATTTCCTATGG - Intergenic
1198387103 X:136139515-136139537 TTGTGGATAAATATTGTTTATGG - Intergenic
1198560310 X:137842734-137842756 TTGGGGATGAATAGTTCACAGGG + Intergenic
1199922506 X:152423792-152423814 ATGTGGACAAATAATTACCAAGG + Intronic
1200475952 Y:3641930-3641952 TTTTGGAGAAATATTTATCAAGG + Intergenic