ID: 1195087038

View in Genome Browser
Species Human (GRCh38)
Location X:101422508-101422530
Sequence CAGGGTCTGAAAAGTATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 10, 3: 31, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195087034_1195087038 19 Left 1195087034 X:101422466-101422488 CCAGATTACAGGTCTGGGTGGTG 0: 5
1: 51
2: 85
3: 169
4: 363
Right 1195087038 X:101422508-101422530 CAGGGTCTGAAAAGTATCTCAGG 0: 1
1: 1
2: 10
3: 31
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195087038 Original CRISPR CAGGGTCTGAAAAGTATCTC AGG Intronic
900756795 1:4440942-4440964 CAGGGTCTGCAAAACATCTCAGG + Intergenic
901412991 1:9098055-9098077 CAGGGCCTGCAAAATATCTCAGG - Intergenic
901631895 1:10652064-10652086 CAAGGTCTGAAAACTCTCACAGG - Intronic
902483174 1:16723151-16723173 AAAGGCCTGAAAAGTAACTCAGG + Intergenic
903830080 1:26169457-26169479 CAGGGACTGGAGATTATCTCGGG + Intergenic
906486402 1:46238696-46238718 CAGGGCCTGCAAAATATGTCAGG + Intergenic
906945090 1:50288576-50288598 CAGGTTCTAAAAAGCATCTCTGG + Intergenic
907133671 1:52119428-52119450 CATGGTCTGCAAAATATCTCAGG - Intergenic
908241539 1:62193067-62193089 CAGGATCTGCAAAATATCTGTGG + Intergenic
908921429 1:69198825-69198847 CAGTGTCTGTGAACTATCTCTGG - Intergenic
909050778 1:70765699-70765721 CATGGTTAGAAAAGTAACTCGGG + Intergenic
911909065 1:103609085-103609107 CAGAGGCTGGAAAGTTTCTCTGG - Intergenic
911913854 1:103670376-103670398 CAGAGGCTGGAAAGTTTCTCTGG + Intronic
912572555 1:110635163-110635185 GAGGGTCAGAGAAGTATCCCTGG - Intergenic
915857373 1:159404096-159404118 CAGAGGCTGAAAAGTATAGCTGG + Intergenic
916523731 1:165589770-165589792 CTGGGACTGAACAGTATCTTTGG - Intergenic
916918461 1:169437249-169437271 CAGGGTCTGCAAAATGTCTCAGG + Intronic
917690010 1:177459171-177459193 CAGAATCTGAAAACTGTCTCAGG + Intergenic
918019934 1:180677540-180677562 CAGGGTCTGCAAAGTATCTCAGG + Intronic
920672939 1:208018346-208018368 AAGGGTCTGAAAAGGATTTGGGG - Intergenic
921469497 1:215531650-215531672 CAGGGTCTGAGATGCATTTCAGG - Intergenic
922989008 1:229889213-229889235 CTGGGTCTGATAAGTGGCTCAGG - Intergenic
923971354 1:239206349-239206371 CAAGGTCTGAGCAGTATCTGGGG - Intergenic
924467841 1:244314196-244314218 CTGGGCTTGAAAAATATCTCAGG + Intergenic
924817269 1:247453623-247453645 TAGGCTCTGAAAAGAAACTCTGG - Intergenic
1062815172 10:494039-494061 CAGGATCTGAAAAGTCACGCTGG + Intronic
1064941330 10:20739194-20739216 CAAGTTCTGCAAAATATCTCAGG + Intergenic
1065247099 10:23769325-23769347 CAGGGTATGCAAAATATCTCAGG + Intronic
1066646044 10:37610157-37610179 CAGTGTCTGAAAAATAACTTGGG - Intergenic
1068189506 10:53632696-53632718 CAGGGTATGGCAAGTATTTCAGG - Intergenic
1068576165 10:58687128-58687150 CAGGGTCTGGAGTGGATCTCCGG - Intronic
1069645848 10:69996683-69996705 TAGAGTCTGAAAATTATCGCTGG - Intergenic
1070807211 10:79277640-79277662 CAGGGGCTGACAGGGATCTCAGG + Intronic
1071959794 10:90799055-90799077 CAGGGTTTGCAAAATATCTCAGG - Intronic
1072211064 10:93247495-93247517 CAGTGTCTGAAAAGCACCTCTGG + Intergenic
1072580223 10:96734178-96734200 CTAGGTCTGTAAAGTGTCTCAGG - Intergenic
1074982672 10:118632314-118632336 CAGCTTCTGATAAGTACCTCAGG - Intergenic
1076506773 10:130982931-130982953 CAGTGTCTTCTAAGTATCTCTGG + Intergenic
1077286695 11:1769422-1769444 CAAGGTCTGCAAAATATCTTAGG - Intergenic
1079101263 11:17543744-17543766 TAGGGTCTGAGAAGTAGCTGAGG - Intronic
1079488704 11:20963299-20963321 CTGGGTCTGAAAAATAACACAGG - Intronic
1081656934 11:44863537-44863559 TAAGCTCTGTAAAGTATCTCAGG - Intronic
1082010727 11:47448280-47448302 CTGGGTCTGAAAAGAAGCTTTGG - Intronic
1084470672 11:69357309-69357331 CTGGGTCAGATAAGTGTCTCAGG + Intronic
1084628123 11:70324599-70324621 AAAGGTATGAAAAGTATTTCAGG - Intronic
1085580381 11:77644855-77644877 CAGGGGCTGCAAAACATCTCAGG + Intergenic
1086699664 11:89886546-89886568 CAGAGTCTGAAAAGACTTTCTGG + Intergenic
1086706507 11:89957970-89957992 CAGAGTCTGAAAAGACTTTCTGG - Intergenic
1087103259 11:94385085-94385107 CAGGGTCTGAAGTGGACCTCCGG + Intronic
1087430316 11:98045350-98045372 CAGTGTCTGAAAACTGACTCGGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1090489174 11:127142890-127142912 CCGGGTCTGAGAGGTTTCTCAGG + Intergenic
1090629045 11:128630193-128630215 CAGGTTCTGAAAATTATCTCCGG + Intergenic
1091213431 11:133884543-133884565 CAGGGTCTGAAGTGGACCTCCGG - Intergenic
1092477601 12:8832244-8832266 CAGGGTCTGCAGAACATCTCAGG + Intronic
1092701628 12:11237715-11237737 CAGTATATGAAAAGTATATCTGG - Intergenic
1093920541 12:24855184-24855206 CAGGTTCTGAAAAACAACTCTGG - Intronic
1096869343 12:54583675-54583697 CAGGGTCTGGAAGGTATAGCTGG + Intronic
1098282751 12:68878421-68878443 CAGGGTCTAAAAAATATCTTAGG - Intronic
1099073829 12:78080488-78080510 AAGGGTAGGAAAAGTATCTCTGG - Intronic
1099151482 12:79119593-79119615 CTGGGTCAGAAAAGGATTTCTGG - Intronic
1100730481 12:97462189-97462211 CAGTGTCTGAAATATATCTAAGG - Intergenic
1100921671 12:99495020-99495042 CAAGGGAGGAAAAGTATCTCAGG + Intronic
1102868316 12:116392077-116392099 CAGGGTTTAAAAGGTATTTCTGG - Intergenic
1103740194 12:123085960-123085982 CAGGGGCTGAGAAGTCTCTGTGG + Intronic
1104416920 12:128603221-128603243 CAGGGGCTGAAATGAATCACAGG + Intronic
1104706430 12:130951024-130951046 CAGGTTCTGAAAAACAACTCCGG - Intergenic
1106113246 13:26795213-26795235 CAGTGCCTGAAAAGTATTTTGGG + Intergenic
1106343922 13:28857869-28857891 CAGAGACTCAAAAGGATCTCTGG - Intronic
1106448879 13:29861958-29861980 CAAGGCCTGAAATGTATCTGTGG - Intergenic
1108114831 13:47115910-47115932 CTGGGACTGAGAAGTTTCTCGGG - Intergenic
1109601907 13:64642542-64642564 CAGGGTCTGCAAAATATCTCAGG + Intergenic
1110187192 13:72689082-72689104 CAGGGCCTTAAAAGCATCTGGGG + Intergenic
1110772194 13:79362477-79362499 CAGTTTCTCAAAAGTATCACAGG + Intronic
1111190086 13:84795596-84795618 CAGGGTCTGCGAAATATCTCAGG - Intergenic
1112332235 13:98485453-98485475 CAGGGCCTGCAAAATATCTCAGG + Intronic
1112642568 13:101292814-101292836 CAGGGAGAGTAAAGTATCTCAGG + Intronic
1114583590 14:23788609-23788631 CAGGATCTACAAAATATCTCAGG - Intergenic
1116708275 14:48331615-48331637 CAGGGGCTGAAGTGTATTTCTGG + Intergenic
1121663358 14:95652611-95652633 CAGGTTCTGAAAAAGCTCTCAGG + Intergenic
1121864534 14:97350331-97350353 CGGGGTTTGAAAAGGGTCTCAGG + Intergenic
1123851505 15:24361949-24361971 CATGGACTGATAAGTATCTGGGG + Intergenic
1125916383 15:43491748-43491770 CAGGGTCTGAAAAAAATAACTGG + Exonic
1131270106 15:90942044-90942066 CAGGGTGTGGAAAGAACCTCAGG + Intronic
1132289707 15:100691162-100691184 CAGGGTCTCAACAGGAGCTCTGG - Intergenic
1133763961 16:8822295-8822317 CAGGGTCTACAAAATATCTCAGG + Intronic
1133831061 16:9324087-9324109 AAGGGACTGAACAGTTTCTCAGG + Intergenic
1133976726 16:10604389-10604411 CCAAGTCTGAAAAGTATCACTGG - Intergenic
1134211960 16:12285028-12285050 CAGGCTCAGAAAAGTAACTGAGG - Intronic
1136060724 16:27724499-27724521 CAGGGTCTTAAGAGTCCCTCAGG + Intronic
1139058634 16:63220888-63220910 CATGGTCTGAATAGTTTTTCAGG - Intergenic
1140646761 16:77039235-77039257 CATGGTGTGGAGAGTATCTCTGG - Intergenic
1141360366 16:83390134-83390156 CAGGGTCTGAAGATTTTCTGGGG - Intronic
1141379683 16:83565145-83565167 AAGAGTCTGAAAAGGATCACTGG - Intronic
1145269065 17:21394854-21394876 CAGGGCCTGGAAAGAATTTCTGG - Intronic
1147242055 17:39096942-39096964 CAGAGTCTGCAAAGCATCTTTGG - Intronic
1147330163 17:39694403-39694425 CAGGGTGTCAAAAGTAGCACTGG + Intronic
1148224035 17:45885769-45885791 CTGGATCTGAAAACTACCTCAGG + Intergenic
1150451573 17:65273253-65273275 CAAGGTCTGCAAAATGTCTCAGG - Intergenic
1150737922 17:67755966-67755988 CAAGGTCTGAAAAATACCTCAGG - Intergenic
1152995529 18:402830-402852 AAGGGTCTGAAGCGTCTCTCAGG + Intronic
1153775073 18:8445544-8445566 CAGGGTTTTAAAAGTTTCTTGGG + Intergenic
1160160237 18:76465255-76465277 CAGGGGCAGGAAAGCATCTCTGG - Intronic
1161446387 19:4321531-4321553 CTGGGACTGAGAAGTATCTGGGG + Intronic
1165792373 19:38500005-38500027 CAGGGTCTCACATGCATCTCTGG - Exonic
1166621915 19:44308903-44308925 CAGGGTTTGAAAAATACCTCAGG + Intergenic
926587593 2:14705527-14705549 CATGGTGTGAAAAGTATCAGTGG - Intergenic
928113893 2:28531609-28531631 GAGGTTATAAAAAGTATCTCTGG - Intronic
928541588 2:32289704-32289726 TAGAGTCTGCACAGTATCTCAGG - Intronic
930153279 2:48079611-48079633 CAGAGTCTGAAAAGTACTTCAGG + Intergenic
931236904 2:60419591-60419613 CTAGGGCTGTAAAGTATCTCAGG - Intergenic
933395387 2:81724671-81724693 CACTGACTGAAAAGAATCTCAGG - Intergenic
937414269 2:121701955-121701977 CAGGGTCTGAAGAATATCTCAGG - Intergenic
938115383 2:128599721-128599743 GAGGGTCTGAAAAATGTCTTTGG - Intergenic
938609187 2:132929494-132929516 CAGAATCTGAAAAGTATTTTGGG + Intronic
939460773 2:142493602-142493624 CTGGGGCTGTAAAGCATCTCAGG + Intergenic
939515329 2:143160056-143160078 CAGGGTGTGCAAAATATGTCAGG - Intronic
940015455 2:149099739-149099761 CAGGGTTTTAAAGGTCTCTCTGG - Intronic
940530153 2:154869289-154869311 CTAGGGCTGTAAAGTATCTCAGG - Intergenic
941561825 2:167056210-167056232 CAGGGACTTAAAAGTAACTGGGG + Intronic
941960306 2:171246669-171246691 CAGAGTCTGCAAAATATCTCAGG + Intergenic
947258367 2:228191613-228191635 CAGGGCCTGAACAGTTTCTAAGG + Intergenic
948069426 2:235107606-235107628 CAGGGTCTGAAATTTGTCTCTGG + Intergenic
948267684 2:236647622-236647644 CAGGTTCTGAAAAGATACTCAGG + Intergenic
1169358031 20:4924316-4924338 CAGGCGTTGAAAAGTATGTCAGG - Intronic
1171124471 20:22589447-22589469 CAGGGTTTGACAAATATTTCTGG + Intergenic
1173161808 20:40658439-40658461 CAGGGGCTAAAAAGGCTCTCAGG + Intergenic
1174139636 20:48403973-48403995 CAGGGTCTCAAAAGCAGCCCAGG - Intergenic
1174537083 20:51259642-51259664 CAGGGTCTGCAAAATACCTCAGG - Intergenic
1175723013 20:61298783-61298805 AGGGGTCTGAAATGTATCGCTGG + Intronic
1175815141 20:61879437-61879459 CTGGTGCTGAGAAGTATCTCTGG - Intronic
1177403029 21:20630894-20630916 CAGGGCCTGAAAAATATTTCCGG + Intergenic
1177657051 21:24031163-24031185 CAGGATCTTAAAATTCTCTCAGG - Intergenic
1178241281 21:30903965-30903987 CAGGGTCTGCAGAATATCTGAGG - Intergenic
1182273346 22:29169770-29169792 CTGGGTCTGAACATAATCTCTGG + Intergenic
1182748685 22:32624818-32624840 CAGAGGCTGAAAGGCATCTCAGG + Intronic
1183251890 22:36736165-36736187 CAGGGGCTGAAAAGAAGCTAAGG - Intergenic
950781495 3:15396740-15396762 CAGGGTCTGGAATGGACCTCCGG - Intronic
950935747 3:16837319-16837341 CAGAGTCTGCAAAATATCTCGGG - Intronic
951536148 3:23742706-23742728 CAGAGGCTGAGAAGTTTCTCAGG + Intergenic
952094045 3:29926882-29926904 CAAGGTTTGACAAGAATCTCAGG + Intronic
952609983 3:35197062-35197084 CAAGGTCTGAGAAATATCACTGG + Intergenic
953612634 3:44460488-44460510 CAGGGTCTGCAAAATATCTCAGG - Intronic
956863971 3:73351465-73351487 CAGGGTCTGCCAGGTATCTGTGG - Intergenic
958861562 3:99450912-99450934 CAGGGTCTGGAATGGACCTCTGG + Intergenic
962177537 3:133169764-133169786 CAGAGCCTGAAAAGCATCTCAGG - Intronic
962475761 3:135753682-135753704 CTGGGTCTGTAAGCTATCTCTGG + Intergenic
963086791 3:141444608-141444630 CTGGGTCTGAAAAGGCTCTGTGG - Exonic
963368614 3:144369149-144369171 CAGACTCTGAAAAGTTCCTCAGG + Intergenic
965764842 3:172119515-172119537 CAGGCTAGGAAAAGTATCTGTGG + Intronic
967244208 3:187470014-187470036 CTAGGGCTGTAAAGTATCTCAGG + Intergenic
969530132 4:7725932-7725954 GAGGGTCTGAGAAGGAGCTCAGG + Intronic
973122050 4:46533435-46533457 CAGGTTCTGGAAAGTGTCCCAGG - Intergenic
973973008 4:56233235-56233257 CAGTCTCTTAAAAGTATCTTTGG + Intronic
974572363 4:63669585-63669607 CAAGGTCAGGAAAGAATCTCAGG - Intergenic
976857714 4:89624639-89624661 CAGGGCCTGAAAAGAAGTTCTGG - Intergenic
978496927 4:109369638-109369660 TGGGATCTGAAAAGTATCACTGG + Intergenic
979303140 4:119110401-119110423 CATGGTTTTAAAAGTCTCTCAGG + Intergenic
979999772 4:127473557-127473579 CAGGGTCTGAAGTGGACCTCCGG + Intergenic
980084666 4:128378834-128378856 CAGAGGCTGAAAAGTACTTCTGG - Intergenic
980777402 4:137454307-137454329 CAGGGTCTGCAAAATATCTCAGG - Intergenic
980872658 4:138627230-138627252 CAGGGTGTGGAAAATATCTCAGG - Intergenic
980890261 4:138807333-138807355 CAGAGTCAGAAAATTATCTCAGG + Intergenic
981138129 4:141236380-141236402 CCAGGTCTGAAAAGTGACTCAGG - Intergenic
986323985 5:6657809-6657831 CAGGGGCTGAAAAGTTTTTGTGG - Intronic
986492095 5:8303651-8303673 CATGCTCTGAAAATTCTCTCAGG + Intergenic
987781047 5:22435755-22435777 CAGGGTCTGCAAAACATCTTAGG - Intronic
987834696 5:23146188-23146210 CAGGGTCAAAAAAGGATCTCTGG + Intergenic
989618951 5:43366449-43366471 CAGGGTCTGAAGTGGACCTCCGG - Intergenic
992203381 5:74405714-74405736 CAGGGCCTGAATAGCTTCTCAGG + Intergenic
992286646 5:75242301-75242323 CAGGGACTGCAAAATATCTTGGG + Intergenic
992963401 5:81977608-81977630 CAGGGTCTGAAAAGAATGCAAGG - Intronic
993871444 5:93259486-93259508 AAGGGTCAGAAAATTATGTCTGG + Intergenic
994434904 5:99715617-99715639 CAGATTCTGAAATGTATGTCTGG - Intergenic
997835608 5:137190694-137190716 CAGGGTGGGAAAAGGATTTCAGG - Intronic
1000831789 5:166111085-166111107 CAGGGTCTGGAAAATATCTCAGG - Intergenic
1001286846 5:170430099-170430121 CAGGGTCGCTGAAGTATCTCAGG - Intronic
1005077861 6:21926195-21926217 CAGGGGTTGAAAAGTTGCTCTGG - Intergenic
1006957282 6:37885090-37885112 CAGGTACTGAAGAGCATCTCTGG + Intronic
1007377019 6:41464009-41464031 CAGACTCTGAAAAGTATAGCAGG + Intergenic
1008227429 6:48937228-48937250 CATTGTGTGAAAAGCATCTCTGG - Intergenic
1008248643 6:49209309-49209331 CTGGGACTGAAAAGGATCACTGG - Intergenic
1010108211 6:72192449-72192471 CTGGGTCTGTAAACTGTCTCAGG + Intronic
1011064644 6:83312013-83312035 CTGGGTCTAAAAATTAACTCAGG - Intronic
1012459618 6:99445951-99445973 AAGGGTCTGAAAAGCATTTTGGG + Exonic
1014766160 6:125409075-125409097 AAGCATCTGAAAAGTCTCTCAGG + Intergenic
1015283902 6:131463229-131463251 CAGGGTTTCAAATGTAACTCTGG + Intergenic
1016028683 6:139315059-139315081 CAGGGCCTGCAAAATATCTCAGG - Intergenic
1018469300 6:164081998-164082020 CAGGGACTGAAAAGTTCTTCTGG + Intergenic
1020145491 7:5639242-5639264 CATTGTCTGAAAAGGAGCTCTGG - Intronic
1020613256 7:10427165-10427187 CATGGTGTGAAGAGTGTCTCTGG - Intergenic
1021196381 7:17678945-17678967 AAGAGTCTGAAAAGCATCTGGGG + Intergenic
1021553653 7:21898389-21898411 CAGAGTCAGGCAAGTATCTCAGG + Intronic
1022272893 7:28827342-28827364 CAGGTTGTGAAAAGGCTCTCAGG - Intergenic
1023229257 7:38008502-38008524 CAGGATCTGACAAGTATTTTGGG - Intronic
1024136719 7:46416220-46416242 CGGGGTCTGCAAAATATGTCAGG - Intergenic
1026123194 7:67555520-67555542 CAGTGTTTGAAAAGGTTCTCTGG + Intergenic
1026287989 7:68980517-68980539 CAGGGTCTGTAAAATATCTCAGG - Intergenic
1026514390 7:71055656-71055678 CAGGGTGTGGAAAGTGTCTTCGG + Intergenic
1027587031 7:80070634-80070656 CAGTGTTTGAAAATGATCTCTGG - Intergenic
1030620901 7:111790284-111790306 CAGGATCTGAGAAGTATCCACGG + Intronic
1031742889 7:125456422-125456444 CAGGGCCAGAAAAGGGTCTCTGG + Intergenic
1032235837 7:130121875-130121897 CAGGTTCTTAAAATAATCTCTGG + Intronic
1038497174 8:28011679-28011701 CAGGGTTTGCAAAATATCTCAGG + Intergenic
1041348361 8:56924384-56924406 CATAGTCTGACAAGTATCACTGG + Intergenic
1042126667 8:65544767-65544789 CAGGATCTTAAAGGCATCTCTGG + Intergenic
1043134649 8:76506240-76506262 CTGGGTCTGAAAATTGACTCAGG + Intergenic
1043743500 8:83844039-83844061 CAGGTTCTGAAAACTACCTTTGG - Intergenic
1044870989 8:96619754-96619776 CAGGGTTTAACAAGTATCTGTGG - Intergenic
1045264668 8:100609057-100609079 GAGAGTCTGAAAAGTTTCACAGG - Intronic
1045658826 8:104414705-104414727 CAGTATCTGAAAAGAATCCCAGG - Intronic
1046443207 8:114283955-114283977 CTAGGTCTGTAAAGTGTCTCAGG - Intergenic
1047601608 8:126431359-126431381 CAGGATCTGAAAAACATCTTAGG - Intergenic
1048219831 8:132531015-132531037 GAGTTTCTGAAAAGTAACTCAGG + Intergenic
1048764278 8:137828592-137828614 CTAGGGCTGAAAAGTGTCTCAGG + Intergenic
1051739156 9:20234980-20235002 CAGGGTCTGGAGTGGATCTCTGG - Intergenic
1051863904 9:21657053-21657075 CAGAGTTTAAAAAGTTTCTCAGG - Intergenic
1053531521 9:38886813-38886835 CAGGGTCACTGAAGTATCTCAGG + Intergenic
1054203745 9:62111241-62111263 CAGGGTCACTGAAGTATCTCAGG + Intergenic
1054634617 9:67477124-67477146 CAGGGTCACTGAAGTATCTCAGG - Intergenic
1055107464 9:72527610-72527632 CAGCGTCTGCAAAGTAGCGCTGG - Intronic
1055335811 9:75232347-75232369 CCTGGTCTGAAAAGTATCCCTGG + Intergenic
1057726492 9:97572168-97572190 CACAGGGTGAAAAGTATCTCAGG + Intronic
1058214495 9:102216957-102216979 CAGGGTCTGCAAAATATCTCAGG + Intergenic
1059413597 9:114149624-114149646 CCAGGTCTGAAAAGTCTCACGGG + Intergenic
1059742531 9:117166000-117166022 CATGGAGTAAAAAGTATCTCTGG + Intronic
1061652087 9:132058866-132058888 CAGTGTCTGAAAATTACCTGTGG + Intronic
1061839719 9:133351429-133351451 CAGTGTCTGTTGAGTATCTCGGG + Intergenic
1185960128 X:4539904-4539926 AAGGGTCTGCAAAATATCTCAGG - Intergenic
1186279012 X:7972677-7972699 CAGGGTCTGCAAAATATCTCAGG - Intergenic
1187844799 X:23524359-23524381 CAGGGTGTGGAGAGCATCTCTGG + Intergenic
1188390728 X:29616088-29616110 CAGGGTCCCAAAAGTATCACTGG + Intronic
1189245213 X:39558079-39558101 CAGGGTCTGATAAGACTTTCTGG - Intergenic
1189761291 X:44324145-44324167 CAGGGTCTGAAAATTATCTTAGG - Intronic
1190575838 X:51837063-51837085 CATGATCTGAAAATTCTCTCAGG + Intronic
1192910727 X:75601750-75601772 CAGGGTCTGAAATGGACTTCCGG - Intergenic
1193150578 X:78119909-78119931 CAGAGTCTTAAAAATAACTCAGG + Intronic
1195087038 X:101422508-101422530 CAGGGTCTGAAAAGTATCTCAGG + Intronic
1197705301 X:129630433-129630455 GAGGGTCTGGAAGGTTTCTCTGG - Intergenic
1198243024 X:134802946-134802968 CAGGGACTTAAAATTATCTCAGG + Intronic
1201694294 Y:16807845-16807867 CAGGCTGTGCAAAATATCTCAGG - Intergenic