ID: 1195094612

View in Genome Browser
Species Human (GRCh38)
Location X:101492150-101492172
Sequence CAGTGGAGGGCTCTGGGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 1, 1: 0, 2: 8, 3: 88, 4: 680}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195094612 Original CRISPR CAGTGGAGGGCTCTGGGCTG GGG Exonic
900319227 1:2074312-2074334 CTGTGGAGGGCTGGGGGCCGGGG + Intronic
900387769 1:2418412-2418434 CAGTGGAGGGGGCAGGGCTCTGG + Intergenic
900566055 1:3332392-3332414 CAGTGGGGGGCTCGGGGCTGGGG + Intronic
900568688 1:3347794-3347816 CCCCTGAGGGCTCTGGGCTGGGG + Intronic
900618027 1:3574050-3574072 CAGTGGGGGTCTCTCGGGTGTGG - Intronic
900629743 1:3628007-3628029 GAGAGGAGGCCTCGGGGCTGGGG + Intronic
900778301 1:4600746-4600768 CTGTGCAGGGCTCCGGGCTGAGG - Intergenic
900829874 1:4958331-4958353 GAGAGGAGGGCTCTGGCCTCAGG - Intergenic
900902858 1:5528460-5528482 CACTGGAGGCTTCTGAGCTGAGG + Intergenic
901026340 1:6280576-6280598 GGCTGGTGGGCTCTGGGCTGAGG - Intronic
901376159 1:8841053-8841075 CAGTGGAGGACTCTGAAGTGAGG - Intergenic
901626871 1:10629693-10629715 CCGTGGAGCCCTCGGGGCTGTGG - Exonic
901670250 1:10851835-10851857 TAGGGGAGGGCTTGGGGCTGGGG - Intergenic
902137894 1:14326543-14326565 CATTGGAGGGCTTTGAGCAGAGG - Intergenic
902323300 1:15683511-15683533 CTGTGGGGGTCTCTGGCCTGTGG + Intergenic
903269531 1:22178681-22178703 CAGTTGAGGGCTCCTGCCTGGGG + Intergenic
903778048 1:25805768-25805790 CAGCAGAGGGCTGTGGGGTGGGG + Intronic
903884946 1:26535659-26535681 CAGAGGGGGGCTCTGGGCTCTGG + Intronic
903972408 1:27127604-27127626 CACTGGAGGGCTCTGGCCTGGGG + Intronic
904306313 1:29592454-29592476 CAGTGGAGGGGTAGGGGCAGAGG + Intergenic
904313569 1:29645308-29645330 CTGTGGAGGCATCTGGGCAGGGG - Intergenic
904385901 1:30141838-30141860 ATGTTGGGGGCTCTGGGCTGGGG + Intergenic
904586247 1:31582503-31582525 CAGTGGAGGGTTTTGGGCAGAGG + Intronic
904771715 1:32884721-32884743 CACTGGAGGGCCCTGGGGTGGGG + Intergenic
904909069 1:33920685-33920707 CAGTGGAGGGTTCTGAGCTGAGG + Intronic
904944835 1:34191591-34191613 AAGTGGAGGGCTCTGGGGTCAGG - Intronic
905150302 1:35921830-35921852 GAATGGAGGGCTCTGGGAGGAGG + Exonic
905307775 1:37031510-37031532 CAGAGGGGCTCTCTGGGCTGAGG - Intronic
905474900 1:38219218-38219240 CAGTGGAGCTCTCTGGACTGTGG + Intergenic
905868949 1:41391987-41392009 CAGCTGTGGGGTCTGGGCTGGGG - Intergenic
906207528 1:43995168-43995190 CGGGGGAGGGCCCAGGGCTGCGG - Intronic
906688101 1:47775408-47775430 CAGGAGAGGGCGCTGGGCTCTGG + Exonic
906870308 1:49472068-49472090 CTGGGCAGGGTTCTGGGCTGTGG - Intronic
907045711 1:51298876-51298898 CAGTGGCGTGCTCAGGGCTTGGG - Intronic
907517280 1:55000628-55000650 CCGTGGAGGGGGCAGGGCTGGGG - Intronic
908827972 1:68151823-68151845 CAGTGGAGAGCTTTGAGCAGAGG + Intronic
909666644 1:78141771-78141793 CAGAGGAGAGGTCTGGACTGTGG - Intergenic
909905777 1:81192814-81192836 AAGTGGAGGCTGCTGGGCTGAGG - Intergenic
909931401 1:81503433-81503455 TGGTGGAGGGCTCTGCGCTGGGG - Intronic
910669447 1:89758293-89758315 CAGGGCAGGGCTCAGGGCTACGG - Intronic
911778648 1:101846959-101846981 CAGTGGAGGACTCATTGCTGTGG + Intronic
912050682 1:105524980-105525002 CAGTGGAGGCCTCTAGGGTTTGG - Intergenic
912953403 1:114135946-114135968 GAGTGGAGCGCTCGGGCCTGGGG + Intronic
913148582 1:116017200-116017222 CAGGGGAGGATTCTGGGCGGAGG - Intronic
913177767 1:116290758-116290780 GATTTGAGGGCTCTGGGGTGGGG - Intergenic
913279805 1:117174937-117174959 CACTTTAGTGCTCTGGGCTGTGG + Intronic
915089771 1:153416318-153416340 CAGGTGAGGTCTCTGGGGTGGGG + Intergenic
915095740 1:153460831-153460853 CAGGTGAGGTCTCTGGGGTGGGG - Intergenic
915235182 1:154475111-154475133 CAGGGGAGGGCTGAGGGCAGGGG + Intronic
916025937 1:160833560-160833582 TGGTGGAGGCCTCTGGACTGAGG - Intronic
916647287 1:166797988-166798010 GGGTGCAGGGCTCTTGGCTGGGG - Intergenic
918409330 1:184242363-184242385 CAGAGGATTGCTCTGGGCTTGGG - Intergenic
920232577 1:204480487-204480509 CAGGGGAGAGCACAGGGCTGGGG - Intronic
920881015 1:209880628-209880650 AATTGGAGGGCTCTGGGATCTGG + Intergenic
921164872 1:212499753-212499775 CATTGGAGGGCTTTGAGCTAAGG + Intergenic
921180006 1:212624724-212624746 CAGTGGGGGCCTGTGGGGTGGGG + Exonic
921190552 1:212704318-212704340 CATTGGAAGCCTTTGGGCTGAGG + Intergenic
921269262 1:213452680-213452702 CTGAGGAGGTCTCTGTGCTGCGG - Intergenic
921343543 1:214158323-214158345 CAGGGAAGGGCTCTAGACTGGGG + Intergenic
921687720 1:218109241-218109263 CAGGGGATGGCTCTGGGATGGGG - Intergenic
921702623 1:218285015-218285037 AAGTGGACCGCGCTGGGCTGGGG + Intergenic
922706851 1:227794747-227794769 CTGTGGCTGGCTCAGGGCTGAGG + Intergenic
923150680 1:231230681-231230703 CAGTGGTGGGGGCTGGGGTGGGG - Intronic
923263810 1:232293202-232293224 CAGCTGCGGGCTATGGGCTGTGG + Intergenic
924062194 1:240186626-240186648 GAGTGCAGTGCTCTGGGCAGAGG + Intronic
924843654 1:247743165-247743187 CAGTGGAGGGCTCTGTGGGCAGG - Intergenic
1062764513 10:50474-50496 CAGTGCAGGGGCCTTGGCTGTGG + Intergenic
1062826173 10:570509-570531 GAGCGCAGGCCTCTGGGCTGCGG - Intronic
1063012741 10:2041305-2041327 CAGTGGATGGCTGTGCGGTGAGG + Intergenic
1065079069 10:22110226-22110248 CACTGGAGGACTATGGGATGTGG - Intergenic
1067272234 10:44802424-44802446 CACTGGAGGCCTCTGGGTGGAGG - Intergenic
1067561352 10:47306958-47306980 CAATGGAGGGCTCCGAGCTTGGG + Intronic
1067813982 10:49457486-49457508 GAGAGGAGGGTTCTGGGCAGGGG - Exonic
1067837481 10:49650668-49650690 CACTGGAGGGTTCTGTGCAGGGG + Intronic
1068008479 10:51418744-51418766 CAGTGGAGGGCTATTGAATGTGG + Intronic
1069806214 10:71126638-71126660 CACTGAAGGGCTGTGGGCTGTGG + Intergenic
1069905247 10:71728428-71728450 CAGTGGAGGACTCTGGGGTGGGG - Intronic
1070098132 10:73358514-73358536 CTGTGGAGGTCGCCGGGCTGGGG + Intronic
1070548381 10:77470499-77470521 CACATGAGGGCTCTGGGCAGGGG + Intronic
1070592738 10:77812081-77812103 CAGTGGGGGGGTCGGGGCTGTGG + Intronic
1070643781 10:78187375-78187397 CAGTGGGGGCCTGTGTGCTGAGG - Intergenic
1070787969 10:79173130-79173152 TCAGGGAGGGCTCTGGGCTGAGG + Intronic
1070916946 10:80161098-80161120 CAGTGGAGGGCCCTGAGCAGAGG - Intronic
1071439292 10:85676288-85676310 CAGTTGCTGGCTGTGGGCTGCGG - Intronic
1071528161 10:86370252-86370274 CACTGGTGGGCTCTGTGCTGAGG - Intergenic
1072617953 10:97062319-97062341 CAGTGTGAGGCTCTTGGCTGTGG - Intronic
1072977264 10:100069512-100069534 CCATGGAGGGCTCTATGCTGAGG + Intronic
1073630488 10:105143391-105143413 CAATGGAGAGATATGGGCTGGGG - Intronic
1075529663 10:123218612-123218634 CACTGGAGGGCTTTGAGGTGTGG + Intergenic
1075539406 10:123299680-123299702 CAGGCGAGGGCTCAGGTCTGGGG + Intergenic
1075626649 10:123968807-123968829 CACAGGAGGGATCTGGTCTGTGG - Intergenic
1075723969 10:124602454-124602476 TGGTGGAGAGCTCTGGGTTGTGG + Intronic
1075735287 10:124661082-124661104 CAATGGAAGGATCTGGCCTGTGG + Intronic
1076014521 10:127016565-127016587 CAGGGCAGGGCGCTGAGCTGAGG + Intronic
1076408664 10:130230744-130230766 CAGGTGCGGCCTCTGGGCTGTGG - Intergenic
1076587757 10:131560895-131560917 GAGAGGGGGGCTCTGGCCTGGGG + Intergenic
1076634818 10:131875334-131875356 GGGTGGAGGGCTCTCAGCTGGGG + Intergenic
1076715439 10:132361703-132361725 CTGTGGCGGGCTCCAGGCTGTGG + Intronic
1076729235 10:132429946-132429968 CAGTGGAGGGCTCAGGTGGGAGG - Intergenic
1076743422 10:132499599-132499621 CAGTGGAAGGTGCTGGGCTGAGG + Intergenic
1076790223 10:132773078-132773100 CGGTGGAGGCCTCTGGGCTGTGG + Intronic
1076889361 10:133276356-133276378 GAGTGCAGGGGTGTGGGCTGAGG - Intronic
1076934317 10:133557198-133557220 CCCAGGAGGGCACTGGGCTGGGG + Intronic
1077047343 11:552356-552378 CCGTGGGGGGATCAGGGCTGGGG + Intronic
1077047366 11:552439-552461 CCGTGGGGGGATCAGGGCTGGGG + Intronic
1077093962 11:791604-791626 CAGAGCTGGTCTCTGGGCTGGGG - Exonic
1077117839 11:893374-893396 CTGTGGAGGGCTCTGGGGTCGGG - Intronic
1077168124 11:1152829-1152851 CAGTGAAGGTTTGTGGGCTGCGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077242744 11:1519293-1519315 CAGTGGATGGATGTGTGCTGGGG - Intergenic
1077243523 11:1524512-1524534 GTGTGGAGGGCTCTAGGGTGAGG - Intergenic
1077272779 11:1689651-1689673 CATGGGTGGGCGCTGGGCTGGGG - Intergenic
1077541568 11:3149032-3149054 CAGTGGGGAGGTCAGGGCTGGGG - Intronic
1077798027 11:5511529-5511551 CAGTGGTGGGCTCTGGCATTAGG - Intronic
1078099343 11:8320592-8320614 CAGGGGATAGCTCAGGGCTGGGG + Intergenic
1078184989 11:9044627-9044649 CAGTGGAGGGCTTTGAGCATAGG - Intronic
1078421186 11:11214355-11214377 CCCTGGAGAGCTCTGGGCTTTGG + Intergenic
1079022691 11:16922879-16922901 CAGTGGAGGCCTCTGTCCTGGGG - Intronic
1079111884 11:17609817-17609839 CACTGGTGGGTTCAGGGCTGTGG - Exonic
1079123122 11:17699200-17699222 CATTCTAGGGCTCTGGGGTGGGG + Intergenic
1079402643 11:20118266-20118288 AAGAGGAGGGCGCTGGGCTCCGG - Exonic
1081863182 11:46345810-46345832 CAGTGGGGGGATCTGGGAAGAGG + Intronic
1081989304 11:47329172-47329194 CAGGGGCGTGCCCTGGGCTGGGG - Exonic
1081998223 11:47378003-47378025 CTGGGGAGGGTGCTGGGCTGAGG - Intronic
1082000199 11:47389947-47389969 CAGGGGAAGGGTCTGGGGTGGGG - Intergenic
1082774933 11:57237492-57237514 AAGTGGAGGGATAGGGGCTGGGG - Intergenic
1082946883 11:58770741-58770763 CAGGGGAAGGCTCTGGAATGCGG - Intergenic
1082988350 11:59186548-59186570 AAGTGGAGGACTCAGGGCTTGGG + Intronic
1083268090 11:61556261-61556283 TTCTGGAGGGCTCTGGGCTGAGG - Intronic
1083627009 11:64077088-64077110 AGGTGGAGGGCACTGGGCTGAGG - Intronic
1083922833 11:65789729-65789751 CAGTGGAGGGCCCAGGAATGTGG + Intronic
1083936456 11:65872427-65872449 CAGTGGCGGGGGCTGGGCTCGGG - Intronic
1084045091 11:66563786-66563808 GAGCAGAGGGCACTGGGCTGGGG - Exonic
1084589132 11:70079872-70079894 CAGTGGAGGGGGGTGGCCTGGGG + Intronic
1084934001 11:72577332-72577354 CAGTGGAGGGCTGTGGGAGGTGG + Exonic
1085320207 11:75569284-75569306 CAGTGCTGGGCTCTGTGATGGGG + Intronic
1087048924 11:93867211-93867233 CACTGGAGGGGTCTGGGTGGAGG + Intergenic
1087234027 11:95698071-95698093 CACTGCAGGGTTCTGGGCAGGGG + Intergenic
1088563043 11:111135071-111135093 CACTGGAGGGTTCTGAGCAGAGG + Intergenic
1088588338 11:111379417-111379439 GTGTGGAGCGCTCTGGGCCGGGG - Exonic
1088728323 11:112658776-112658798 GAGGGGAGGGAGCTGGGCTGTGG - Intergenic
1088781325 11:113136743-113136765 CAGTGCAGGAGGCTGGGCTGTGG + Intronic
1089704969 11:120271492-120271514 GAGAGGTGGGCCCTGGGCTGGGG - Intronic
1089739693 11:120573871-120573893 CAGTGTGGGCCTCTGGGATGTGG - Intronic
1090387135 11:126363901-126363923 CAGAGGCAAGCTCTGGGCTGGGG - Intronic
1091002750 11:131924128-131924150 CAGTGCAGGGCACGGAGCTGGGG + Intronic
1091112107 11:132979277-132979299 CAGGGGAGGGCTCAGGACAGAGG - Intronic
1091339509 11:134799378-134799400 CAGAAGATGGGTCTGGGCTGGGG - Intergenic
1091513479 12:1153818-1153840 CAGGGGAAGGCGCAGGGCTGGGG - Intronic
1091699310 12:2649616-2649638 CAGGGGAGGGCTCTGAACAGTGG + Intronic
1091700360 12:2654954-2654976 CAGTGTAGGGATTTGGGCTCAGG + Intronic
1091903211 12:4162165-4162187 CAGTGAAGCTCTCTGGGCTGTGG - Intergenic
1092288608 12:7144826-7144848 CTGTGGAAGGCCCCGGGCTGTGG + Intronic
1092586956 12:9909819-9909841 CAGGGGAGGGATCTGGAGTGGGG + Intronic
1092894387 12:12999026-12999048 CAGTGGAGTGTCCTGAGCTGGGG - Intronic
1093478167 12:19578031-19578053 AAGTGGAGGCCTCCAGGCTGAGG + Intronic
1094118191 12:26939270-26939292 CAGTGGAGGGCGGGGGGCAGAGG - Intronic
1094359354 12:29613300-29613322 CAGTGGGAGGCTGTGGCCTGAGG + Intronic
1094814303 12:34168186-34168208 CAGTGCAGGGGCCTTGGCTGTGG + Intergenic
1095102621 12:38200403-38200425 CAGTGCAGGGGCCTTGGCTGTGG - Intergenic
1095566823 12:43634054-43634076 GAGTGGAGGGCTGGGGGCGGTGG - Intergenic
1096156131 12:49342441-49342463 CAGTGGAGGACTGTGGCCTGAGG + Intergenic
1096214324 12:49791239-49791261 CAGTGCGGGGCTGGGGGCTGGGG + Exonic
1096791308 12:54046927-54046949 GCGAGGAGGCCTCTGGGCTGTGG + Intronic
1098963629 12:76763985-76764007 CGGCGGAGGGCTCTGGGCGTGGG - Exonic
1099354043 12:81611397-81611419 CAGTGAAGAGCTCAGTGCTGCGG - Intronic
1100697993 12:97116625-97116647 CAGAAGACAGCTCTGGGCTGAGG - Intergenic
1101396798 12:104355878-104355900 CACTGGAGGGCTCTGAGCAGAGG + Intergenic
1101743645 12:107521585-107521607 CAGTGGAGGACTCTGAACAGAGG - Intronic
1101750447 12:107579051-107579073 CAGAGGAGTCCTCTGGGGTGAGG + Intronic
1102017423 12:109657017-109657039 CAGAGGCGTGCACTGGGCTGGGG - Intergenic
1102258192 12:111428304-111428326 CAGCGGGGGGCTCAGGGCTGAGG - Intronic
1102579637 12:113878218-113878240 CAGAGAGGGGCCCTGGGCTGGGG - Intronic
1102961865 12:117098621-117098643 CAGGGGAGGACGCTGGGCTCCGG + Intronic
1103158256 12:118706201-118706223 CAGGGGAGGGGTGTGGGCTGAGG - Intergenic
1103202252 12:119097258-119097280 CTGTGGAGGGCTGAGGGCTGTGG + Intronic
1103452515 12:121039177-121039199 CACAGGAGGACTCTGGGCTGAGG + Exonic
1103995438 12:124826946-124826968 CAGGAGAGGGCTGGGGGCTGGGG + Intronic
1104657103 12:130581541-130581563 CACGGGAGGGCTGTGGGGTGGGG - Intronic
1104841579 12:131828415-131828437 GAGCGGAGGGCGCCGGGCTGCGG + Exonic
1104854590 12:131895822-131895844 CAGGTAAGGCCTCTGGGCTGCGG + Exonic
1104898601 12:132176078-132176100 TGCTGGAAGGCTCTGGGCTGAGG - Intergenic
1105213442 13:18271239-18271261 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
1106072218 13:26423882-26423904 CAGTGCAGGGCTATGGGCCCTGG - Intergenic
1106182709 13:27382139-27382161 GTGTGGGGGGCTCAGGGCTGGGG - Intergenic
1111322831 13:86651943-86651965 CAGTGGGGGACTCTGAGCTTAGG + Intergenic
1112707319 13:102085363-102085385 CAGTTGAGGGATTTGGGGTGAGG - Intronic
1112783396 13:102926324-102926346 CACTGGAGGGCTCTGAGCAGAGG + Intergenic
1113261632 13:108571264-108571286 CAGAGGATGGCTCAGGACTGAGG + Intergenic
1113736031 13:112679646-112679668 CTGGGGAGGGCTCCGAGCTGTGG + Intronic
1113785031 13:112997924-112997946 CAGGAGTGGGCTCTTGGCTGAGG + Intronic
1114334740 14:21676616-21676638 CAGTGGTGCGATCTCGGCTGAGG - Intergenic
1114530166 14:23390473-23390495 CAGTGGAGGGGTCCAGGCGGTGG - Intronic
1114535595 14:23420260-23420282 CAGTGGAGGGGTCCAGGCGGTGG - Intronic
1114654100 14:24305663-24305685 CAGTGGAGGGGGCTGAGCAGTGG - Exonic
1115774592 14:36701401-36701423 CCTTGCAGGGCTCTGGGCTTTGG + Intronic
1117008385 14:51445351-51445373 CAGTGGTTGGGTCTGGGTTGAGG + Intergenic
1118846027 14:69548370-69548392 CTGTGGATGGCTCTGGAGTGAGG - Intergenic
1119391767 14:74295819-74295841 CACTTGAGGTTTCTGGGCTGGGG - Intronic
1119474925 14:74921614-74921636 CAGTGGAGGAAACTGGGGTGCGG - Intronic
1119531467 14:75364302-75364324 GCATGGAGGACTCTGGGCTGCGG + Intergenic
1120371031 14:83636078-83636100 CAGTGGTGGGATCTCGGCTCAGG + Intergenic
1120981978 14:90298332-90298354 CAGTGGAGAGCCCCGGGCTGGGG - Exonic
1121238717 14:92412540-92412562 GACAGGAGGGCTGTGGGCTGTGG - Intronic
1121559453 14:94863918-94863940 AAGGGGAGGGCTATGGGTTGGGG + Intergenic
1121963970 14:98287543-98287565 CACTGGAGGCCACTGGGCAGTGG + Intergenic
1122153272 14:99735942-99735964 CAGGGGAGGCCTCAGGGCTGGGG - Intergenic
1122273175 14:100577526-100577548 CTGCAGAGGGCTCTGGGCTGCGG + Intronic
1122573678 14:102726692-102726714 CAGTGGAGCTCTCTGGGAAGTGG - Exonic
1122651833 14:103230667-103230689 CAGGGGCTGGCTCTGGGCTATGG - Intergenic
1122850618 14:104527789-104527811 CAGGGGAGGGCTATCTGCTGGGG - Intronic
1123105720 14:105840270-105840292 CAGGGGTGGGCACTGGGCAGGGG - Intergenic
1123585671 15:21758997-21759019 CAGTGGAGGGTTCTGAGCAACGG + Intergenic
1123622313 15:22201585-22201607 CAGTGGAGGGTTCTGAGCAACGG + Intergenic
1124107456 15:26753373-26753395 CAGTTGAGGGCTCCACGCTGAGG + Intronic
1124390415 15:29250644-29250666 CAGTGCAGGGCTCTGTGTGGGGG - Intronic
1124619657 15:31266436-31266458 CAGTGGAGGGGGCTGGGGCGGGG - Intergenic
1125596907 15:40893335-40893357 AAGTGGAAGGCTCTGGACTAGGG - Intergenic
1125725648 15:41866924-41866946 CAGTGGAAGGCCCTGGGCTGGGG + Intronic
1126492003 15:49247322-49247344 CTTTGGAGGGCTGTGAGCTGGGG + Intronic
1127974281 15:63985685-63985707 CAGTGCAGGGCTGGGAGCTGGGG - Intronic
1128155450 15:65388967-65388989 GTGTGGAGGGCCCTGGGGTGCGG + Exonic
1128751711 15:70154812-70154834 CTGTGCCGGGCTCTGGGCTCTGG + Intergenic
1129237041 15:74229903-74229925 CAGGGGAGGCCCATGGGCTGTGG + Intergenic
1129295065 15:74595738-74595760 TGGTGGAGGGCTCTGCGCTGGGG - Exonic
1129301841 15:74629963-74629985 CATTGGGTGGCTCTGGCCTGGGG - Exonic
1129412232 15:75356357-75356379 AGGTGGCGGGCGCTGGGCTGGGG + Exonic
1129468754 15:75738661-75738683 GAGTGGCTGGCACTGGGCTGGGG - Intergenic
1129599252 15:76988707-76988729 CAGTGGAGGACTCTGGGGCAAGG + Intergenic
1129602728 15:77009726-77009748 CAGAGGAGGAATCTGGGCTCAGG + Intronic
1129685088 15:77681388-77681410 CAGTGGAGTTGGCTGGGCTGGGG + Intronic
1129907437 15:79198536-79198558 CAGTGGCTGGGACTGGGCTGGGG + Intergenic
1129956122 15:79638258-79638280 CAGTGGTGGGCTCTGGCGTTAGG + Intergenic
1130078488 15:80710390-80710412 CATTGGAGGGCTTTGGGTAGAGG + Intronic
1130550720 15:84888657-84888679 CTGAGGAGGGGACTGGGCTGGGG - Intronic
1130857701 15:87855780-87855802 CAGTGGAGGGTTTTAGGCTGAGG - Intergenic
1132298534 15:100762342-100762364 CAGCGGAGTGCTCTGAGTTGAGG + Intergenic
1132643118 16:987079-987101 GCGTGGAGGGCACTGGGGTGAGG - Intergenic
1132665770 16:1080696-1080718 CAGAGGAGAGCTGGGGGCTGAGG + Intergenic
1132694569 16:1196147-1196169 CACTGCTGGGGTCTGGGCTGGGG - Intronic
1132756989 16:1490336-1490358 CCCTCGAAGGCTCTGGGCTGGGG - Intergenic
1132767096 16:1539916-1539938 CCCTGGAGGTCTCAGGGCTGGGG + Intronic
1133118606 16:3592605-3592627 CTGCAGAGGGCTCGGGGCTGAGG - Intronic
1133331376 16:4976706-4976728 CAGCTGTGGGCTCTGGGCTTTGG + Intronic
1133547683 16:6823838-6823860 AAATAGAGGGCTCTGTGCTGTGG + Intronic
1133701140 16:8310323-8310345 CTGGGGAAGTCTCTGGGCTGGGG - Intergenic
1134024627 16:10944563-10944585 CAGTGCTGGGCTGTGGGCCGGGG + Exonic
1134178707 16:12030281-12030303 CAAGGAAGTGCTCTGGGCTGCGG - Intronic
1134875838 16:17697784-17697806 CAATGGAGGGTTCTGGGATGTGG + Intergenic
1134885412 16:17786592-17786614 CACTGGAGGGCTTTGAGCTGGGG - Intergenic
1135852570 16:25977881-25977903 CAGCTGAGGGCTCTAGGCAGGGG - Intronic
1136019476 16:27430873-27430895 CACTGGTGGTCCCTGGGCTGGGG + Intronic
1136136534 16:28259747-28259769 CCATGGAGGGCTCTGAGCAGGGG - Intergenic
1136714441 16:32265647-32265669 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136753448 16:32663770-32663792 TTGTGGATGGCTCTGGGCTGGGG - Intergenic
1136814665 16:33206595-33206617 TTGTGGATGGCTCTGGGCTGGGG + Intronic
1136821141 16:33316675-33316697 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136827704 16:33373214-33373236 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136832770 16:33471985-33472007 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1137293372 16:47067376-47067398 CAGGGGAGAGCGCTGGGATGTGG + Intergenic
1137555917 16:49470319-49470341 TAATGGGGGGCTCTGGGCGGAGG + Intergenic
1137627868 16:49920962-49920984 CAGTGGACGAGTGTGGGCTGGGG + Intergenic
1138171303 16:54852161-54852183 CAGTTGAGAGCTCTGGGTTTTGG + Intergenic
1138556581 16:57774465-57774487 AAGTGGGGGTCTCTGGGCTGTGG + Intronic
1138586527 16:57973831-57973853 CAGTAGTGGGCTCTAGGGTGGGG + Intergenic
1139572622 16:67822726-67822748 AAGTGCAAGGCCCTGGGCTGGGG + Intronic
1139594834 16:67951513-67951535 CAGTGGCGGGCTCTGGGTGACGG - Intronic
1139671188 16:68493254-68493276 CAGCGGAGGCCTGGGGGCTGAGG - Intergenic
1140055856 16:71525151-71525173 CAGTGAAGGACTTTGGGCAGAGG - Intronic
1140113415 16:72022308-72022330 CACTGCAGGGCTGTGGTCTGCGG + Intronic
1140128102 16:72134522-72134544 CAGTGGAGGGTTTTGAGCTGAGG - Intronic
1140427335 16:74871877-74871899 TAGTGCTGGGCTCTGGTCTGAGG - Exonic
1141413114 16:83849688-83849710 CAAGGGAGGACTCTGGGCTTGGG + Intergenic
1141500221 16:84438974-84438996 CAGGGGAGGGCTCAGGACAGTGG + Intronic
1141622155 16:85242036-85242058 GAGTGGAGGGCTCAGGGCAGAGG - Intergenic
1141678235 16:85528994-85529016 CCATGGAGGGTTCTGGGCAGAGG + Intergenic
1141932281 16:87213987-87214009 CCATGGAAGGCTGTGGGCTGTGG + Intronic
1142075315 16:88114383-88114405 CTGTGGGGGTCTCTGGGGTGGGG + Intronic
1142107077 16:88309924-88309946 CAGTGGAGGGATCTGGCCTCTGG - Intergenic
1142145811 16:88492551-88492573 CAGATGAGGGCCCTGGGCTCTGG - Intronic
1142165965 16:88588293-88588315 CAGTGCAGTGCTCTGGTCTCTGG + Intronic
1142202355 16:88767376-88767398 GGCTGGGGGGCTCTGGGCTGTGG - Intronic
1142440139 16:90092771-90092793 CAGTGCAGGGGCCTTGGCTGTGG - Intergenic
1202993241 16_KI270728v1_random:29569-29591 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1203055609 16_KI270728v1_random:924122-924144 TTGTGGATGGCTCTGGGCTGGGG - Intergenic
1142467519 17:144751-144773 CAGTAGAGGGCCCTGGACTGGGG + Intergenic
1142636331 17:1260090-1260112 CAGGGTCGGGCTCTGAGCTGGGG - Intergenic
1142647000 17:1320626-1320648 CAATGGAGGGCTGGGGGCAGTGG + Intergenic
1143632534 17:8147294-8147316 CACTGGAGGACCCAGGGCTGTGG + Exonic
1143642411 17:8206700-8206722 CAGTAGGGGGCTCGAGGCTGAGG - Intronic
1143710352 17:8730237-8730259 CAGGGGAGGCCTCTGGGGGGCGG - Intronic
1144140556 17:12343055-12343077 CTGTGGAGGGTGCTGGGCTTTGG - Intergenic
1144214947 17:13047165-13047187 CAGTGAAGGAATCTGGGCTTTGG - Intergenic
1144654740 17:17028455-17028477 CACTGCAGGGCACTGGCCTGTGG - Intergenic
1144683003 17:17207241-17207263 CAGCCGAGGGCACTGGGCCGGGG + Intronic
1144825944 17:18105820-18105842 CAGTGGAGGGCGGTGGGGAGGGG - Intronic
1144832090 17:18137454-18137476 CTGTGGAGGGTTGTGAGCTGAGG + Intronic
1145160141 17:20568498-20568520 CACTGCAGGGCACTGGCCTGTGG + Intergenic
1145255610 17:21320610-21320632 CACTGGAGGGCTGTGAGCCGGGG + Intergenic
1145272879 17:21413957-21413979 CTGGGGAGGGCCCTCGGCTGAGG + Intronic
1145311088 17:21701420-21701442 CTGGGGAGGGCCCTCGGCTGAGG + Intronic
1145321003 17:21767339-21767361 CACTGGAGGGCTGTGAGCCGGGG - Intergenic
1146558916 17:33851246-33851268 CAGGGGAGGGCCCTAGGCAGAGG + Intronic
1146668389 17:34720052-34720074 CAGGGTAGGAGTCTGGGCTGTGG + Intergenic
1146884724 17:36463572-36463594 CAGTGAAGGGCTCTGCAGTGAGG - Intergenic
1146890160 17:36501648-36501670 GAGTTGAGGGGTCGGGGCTGAGG - Intronic
1146936646 17:36816384-36816406 CAGCAGAGGTCTCTGGGCAGTGG - Intergenic
1147191985 17:38743414-38743436 CAGTGTGGGGCTCTCGGCTGTGG - Intronic
1147429083 17:40360838-40360860 GTGTGGAGGGGTCTGGGTTGTGG + Exonic
1147587052 17:41658801-41658823 CAGAGGAGGACTCTGGGCAATGG - Intergenic
1147652162 17:42068879-42068901 CAGAGAAGGGCTCTGGGGAGGGG + Intergenic
1147761264 17:42798893-42798915 CTGTGGAGGGTTCGAGGCTGTGG + Exonic
1147794320 17:43031804-43031826 GGGAGGAGGGCTCTGGGCTGAGG + Intergenic
1147922853 17:43929025-43929047 CAGTGGTGGGCTCTGGCATGAGG - Intergenic
1148188316 17:45660688-45660710 CAGTGGACGGCTCTGGGGCCTGG - Intergenic
1148546970 17:48526523-48526545 CAGTGGAGCCTTCTGGGTTGGGG - Intergenic
1148629059 17:49092595-49092617 CACTGGAGGTGCCTGGGCTGGGG + Intergenic
1148694424 17:49550394-49550416 CAGCGGAGGGCCCAGGGCTGTGG - Intergenic
1150446502 17:65230704-65230726 GAGTGCAGGGCTGTGGGCTGTGG + Intergenic
1150657836 17:67051887-67051909 CAGCGGAGGGCCCTGAGATGAGG - Intronic
1150730367 17:67687723-67687745 CAGTGAAGGGGTGTGAGCTGGGG + Intronic
1151334652 17:73432674-73432696 GAGGGGAGGGCTGGGGGCTGGGG + Intronic
1151418565 17:73982742-73982764 CAGAGGAGGGCTCTTGACTTTGG - Intergenic
1151903839 17:77035074-77035096 AAGTGGTTTGCTCTGGGCTGTGG + Intergenic
1151907103 17:77056007-77056029 GAATGGAGGCCTGTGGGCTGGGG - Intergenic
1152076168 17:78161262-78161284 CGGTGGGGGGCACAGGGCTGAGG + Intronic
1152092261 17:78253470-78253492 CAGAGGAGGGTTCTGAGATGTGG - Intergenic
1152110882 17:78357287-78357309 CTGTGCAGGGCTCGGGGCAGTGG + Exonic
1152139857 17:78529936-78529958 TAGTGAAGGCCTCTGGGATGTGG - Intronic
1152144527 17:78560390-78560412 CACTTGTGGGCTCTGGGATGTGG - Intronic
1152957415 18:50790-50812 CAGTGCAGGGGCCTTGGCTGTGG + Intronic
1153493000 18:5669320-5669342 CACTCGGGGACTCTGGGCTGAGG - Intergenic
1153817336 18:8801853-8801875 TCCAGGAGGGCTCTGGGCTGTGG - Intronic
1156248507 18:35327363-35327385 GAGAAGAGGTCTCTGGGCTGGGG + Intergenic
1156472701 18:37387601-37387623 AAGTTGAGGACTCTGGTCTGGGG + Intronic
1157300935 18:46478563-46478585 CACTGGAGGGTTCTGAGCAGGGG - Intronic
1157534404 18:48447934-48447956 CATTGGAAGGCTCTGAGCAGAGG - Intergenic
1157598501 18:48878291-48878313 CAGGGGAGGCTTCTGGTCTGGGG + Intergenic
1158415534 18:57246827-57246849 AAATGGAGGCCTCAGGGCTGTGG + Intergenic
1158539413 18:58339188-58339210 AAGGGGAGGGCTCTGGGCGGAGG + Intronic
1158587692 18:58755826-58755848 GAGTGGAGGGCTGAGGGCTGAGG + Intergenic
1160333352 18:78015656-78015678 CGGGGAAGGGCTCTGTGCTGAGG - Intergenic
1160733670 19:652239-652261 CGGTGGCCGGCTCTGGTCTGTGG + Exonic
1160754750 19:751448-751470 CCTTGGAGGGCTCTGGGATTTGG - Intronic
1161012863 19:1968609-1968631 CAGCGAGGGGCTGTGGGCTGGGG + Intronic
1161226125 19:3146808-3146830 CCATGGAGGGCTGTGGGCAGAGG - Intronic
1161289435 19:3485123-3485145 CCATGGAGGGCTGTGGGCAGAGG + Intergenic
1161480112 19:4506160-4506182 CCCTGGAGGGCTCTGGGCAGAGG - Intronic
1161541047 19:4851741-4851763 CCATGGAGGGCTGTGGGCAGAGG + Intronic
1161599197 19:5170537-5170559 CCATGGAGGGCTGTGGGCAGAGG + Intronic
1161605626 19:5213279-5213301 CCATGGAGGGCTGTGGGCAGAGG - Intronic
1161619175 19:5289468-5289490 CCATGGAGGGCTGTGGGCAGAGG - Intronic
1161621391 19:5299160-5299182 CCATGGAGGGCTGTGGGCAGAGG - Intronic
1161624680 19:5319542-5319564 CTATGGAGGGCTGTGGGCAGAGG - Intronic
1161636639 19:5393407-5393429 GAGAGGAGGGTTCTGGGCAGAGG - Intergenic
1161661142 19:5547017-5547039 CCATGGAGGGCTCTGGACAGAGG + Intergenic
1161713904 19:5864973-5864995 CAGTGGTGTGCACTTGGCTGGGG - Intergenic
1161796714 19:6391276-6391298 CAAGGGAGGGGACTGGGCTGGGG - Intronic
1162806083 19:13138705-13138727 CAGGGGAGGGGGCTGGCCTGGGG + Exonic
1163028638 19:14529156-14529178 CAGGAGAGGGCTAGGGGCTGGGG - Intronic
1163264073 19:16207823-16207845 CAGTGGCTGGCTGTGGGGTGGGG - Intronic
1163320000 19:16569002-16569024 GAGTGGAGAGCTCTCTGCTGGGG - Intronic
1163607145 19:18281588-18281610 CAGTGGAGGGCCGGGCGCTGCGG - Exonic
1163659399 19:18567795-18567817 CAGAGCAGGGAGCTGGGCTGAGG + Intronic
1163678119 19:18665689-18665711 CAGAGCAGGGCTGTGGGGTGGGG + Intronic
1163782264 19:19256768-19256790 AGGTGGAGGTCTCTGGGGTGGGG + Exonic
1163863743 19:19755735-19755757 CAGTGGAGGGACCTGGTCAGTGG - Intergenic
1164439208 19:28259231-28259253 GAGGAGAGGGCTCTGGGCCGTGG + Intergenic
1165049307 19:33131654-33131676 CAGCGGAGGGCTGGAGGCTGGGG + Intergenic
1165124031 19:33581424-33581446 CAGTTGAGGTGACTGGGCTGGGG + Intergenic
1165150559 19:33757895-33757917 CTCTGGAAGGCTCTGGCCTGAGG - Intronic
1165184670 19:34007454-34007476 CTGTGGGTAGCTCTGGGCTGAGG - Intergenic
1165489337 19:36114314-36114336 GAGTGGCGGGCCCTGAGCTGGGG - Intronic
1165718653 19:38063364-38063386 CTGAGGATGGCTCTAGGCTGAGG - Intronic
1165719759 19:38070851-38070873 CTCTGGAGGGCTCAGGGATGTGG - Intronic
1165758861 19:38309164-38309186 CTGTGGGGGGCTCAGGGGTGGGG - Intronic
1165761929 19:38326689-38326711 CAGTGACAGGCGCTGGGCTGAGG - Exonic
1165888981 19:39099246-39099268 CCGTGGAGGGGACAGGGCTGGGG + Intronic
1165891204 19:39113398-39113420 CACAGGAGGGCTCTGAGCAGGGG - Intergenic
1166673906 19:44727696-44727718 CCATGGAGGGTTCTGGGCAGGGG - Intergenic
1166877925 19:45909187-45909209 CACAGGAGGGCTCTGAGCAGAGG + Intergenic
1167053769 19:47096023-47096045 CAGTGGAGGGTCCTGGGAGGAGG - Intronic
1167085389 19:47306255-47306277 CAAGGGAGGGCTCTGAGCTGTGG + Intronic
1167138344 19:47632095-47632117 CATGGGAGGGCTTTGAGCTGGGG + Intronic
1167243360 19:48358829-48358851 CATGGGAGGGCTCTGAGCTGAGG - Intronic
1167269842 19:48500578-48500600 CAGAGGAGGTAACTGGGCTGGGG + Intronic
1167573416 19:50305100-50305122 CATGGGAAGGCTGTGGGCTGGGG + Intronic
1167612071 19:50512493-50512515 CAGTGCAAGGCCCAGGGCTGTGG + Exonic
1167744577 19:51342972-51342994 CAGGGGAGGGCTGTGAGCAGGGG - Intergenic
1168088149 19:54063602-54063624 CGGTGGGTGGGTCTGGGCTGTGG - Intronic
1168401217 19:56087227-56087249 CCGCGGAGGGCTCTAGGCAGGGG - Intergenic
925307379 2:2858779-2858801 GAGAGGAGGGCTGAGGGCTGAGG - Intergenic
925920177 2:8632808-8632830 CAGTGAGGGGCTCTGAACTGTGG + Intergenic
926119524 2:10234612-10234634 AAAAGGAGGGCACTGGGCTGAGG + Intergenic
926166165 2:10523088-10523110 CAGCAGAGGGCAGTGGGCTGGGG + Intergenic
926214739 2:10897900-10897922 CACTGGAGGAATCCGGGCTGAGG + Intergenic
926700374 2:15799450-15799472 CAGTGCAGGGCTCTGGGTCTGGG + Intergenic
927687023 2:25178191-25178213 CAGCTGAGTCCTCTGGGCTGAGG + Intergenic
927693044 2:25221903-25221925 CAGTGGAGGGCCCAGGGCTCCGG - Intergenic
928149254 2:28811138-28811160 CCGCAGCGGGCTCTGGGCTGAGG + Intronic
928291106 2:30038002-30038024 GTGTGGAGGCCTCAGGGCTGCGG + Intergenic
928424723 2:31168537-31168559 GAGTGGAGGGGGCTGGCCTGGGG + Intergenic
928649064 2:33386034-33386056 CAGTGGAGGGTAATGGGTTGGGG - Intronic
929443904 2:41988137-41988159 CAGTGGTAGGCAATGGGCTGCGG + Intergenic
929511328 2:42568381-42568403 AAGTGGAGGGCCCTGGGGTCAGG - Intronic
929915483 2:46132105-46132127 CAGTGAAGGGCTCTGAACTTGGG - Intronic
930024124 2:47020138-47020160 CAGTGAAGGGCTGTGGGGAGCGG + Intronic
930154762 2:48094670-48094692 CAGTGCAAGGCTCTTGGTTGGGG - Intergenic
930304955 2:49665974-49665996 GAGTTGAGTGCTCTGTGCTGGGG + Intergenic
930858970 2:56050014-56050036 TGGTGGAGAGCTCTGGGCTAAGG + Intergenic
932447641 2:71790684-71790706 CAGCCAAGGGCTCTGGGCAGGGG - Intergenic
933304244 2:80577496-80577518 CACTGGAGGGTTCTGAGCAGGGG + Intronic
933894357 2:86797191-86797213 CAGAAGAGGGGTCAGGGCTGGGG + Intronic
934050856 2:88209659-88209681 CAGTGGAGGCCTGAGGGCAGAGG - Intergenic
934300882 2:91775505-91775527 CAGTGCCAGGCTCTAGGCTGAGG + Intergenic
935285597 2:101561333-101561355 CAGGGGAGGGGCCTGGGTTGGGG + Intergenic
935698094 2:105787139-105787161 CAGCTGAGTGCTCAGGGCTGAGG - Intronic
936285025 2:111175018-111175040 CAGTGGAGGGCTCTTGTCACAGG + Intergenic
936891739 2:117378563-117378585 CTGTGGAGGGCTTGGGGCAGTGG + Intergenic
936966218 2:118129836-118129858 GAGTGCGCGGCTCTGGGCTGAGG - Intergenic
937916255 2:127100444-127100466 CAGTAGTGGGGTCTGGCCTGGGG - Intronic
938093730 2:128448734-128448756 CAGGAGAGGGGTCTGGGCCGAGG + Intergenic
938243544 2:129760887-129760909 CACAGCAGGGCTCAGGGCTGAGG + Intergenic
938312342 2:130301505-130301527 CAGTGGAGGGGGATGGGTTGGGG + Intergenic
940605922 2:155924349-155924371 CAGTGGAGGCCTCTAGGATTTGG - Intergenic
941601705 2:167550993-167551015 CAGTAGAGGTCTGTGGGCCGTGG - Intergenic
943385363 2:187197627-187197649 CAGTGTGTGGCTCTGGGGTGGGG + Intergenic
944483578 2:200180996-200181018 CAGAGGAAGTCTGTGGGCTGAGG + Intergenic
944599542 2:201289597-201289619 CCCTGGATGGCTCTGGGTTGGGG - Intronic
945046581 2:205787226-205787248 ATGTGGAGGGCCCTAGGCTGGGG - Intronic
946181291 2:217950678-217950700 CAGTGGACAGCTCTGGGCTTTGG - Intronic
946237381 2:218332484-218332506 CAGGGCAGGGCACAGGGCTGGGG + Intronic
946339124 2:219057162-219057184 CTGTGGCAGGCTCTGGACTGTGG + Intronic
946969344 2:225074506-225074528 TGGTGGAGGGATCTGTGCTGTGG + Intergenic
947919604 2:233857630-233857652 CAGTAGAGGGCACTGTGCAGGGG - Intergenic
948532474 2:238618666-238618688 CGGAGGAGGGCTCTGGCCTGTGG + Intergenic
948645993 2:239405303-239405325 CAGTGGAGGGAGCAGGGGTGGGG + Intergenic
949032872 2:241805257-241805279 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032888 2:241805296-241805318 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032919 2:241805374-241805396 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032935 2:241805413-241805435 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032952 2:241805452-241805474 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032969 2:241805491-241805513 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032986 2:241805530-241805552 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033033 2:241805643-241805665 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033079 2:241805756-241805778 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033199 2:241806050-241806072 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033215 2:241806089-241806111 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033232 2:241806128-241806150 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033247 2:241806163-241806185 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033291 2:241806272-241806294 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033323 2:241806351-241806373 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033355 2:241806428-241806450 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033388 2:241806506-241806528 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033418 2:241806580-241806602 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033434 2:241806619-241806641 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033480 2:241806732-241806754 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033511 2:241806806-241806828 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033527 2:241806845-241806867 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033543 2:241806884-241806906 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033574 2:241806962-241806984 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033650 2:241807149-241807171 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033710 2:241807305-241807327 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033755 2:241807422-241807444 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033772 2:241807461-241807483 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033804 2:241807538-241807560 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033855 2:241807663-241807685 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033902 2:241807780-241807802 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033919 2:241807819-241807841 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033971 2:241807944-241807966 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
1168763893 20:368797-368819 CAGGGGAGAGGTCTGGGCTGAGG - Intronic
1168770183 20:409396-409418 CAGGGGAGGCCTCTGGGAGGGGG - Intronic
1168807131 20:678240-678262 CAGGGAAGGACTCTGGGCAGTGG - Intergenic
1168814326 20:726454-726476 CAGAGGTGGGCTCTGGGGTGAGG - Intergenic
1169080592 20:2795940-2795962 CAGTGGAGGTCTGTGGGGGGCGG - Intronic
1169142804 20:3235726-3235748 CACTGCAGGGCTCAGGGCAGAGG - Intronic
1170258778 20:14378478-14378500 CAGCAGAGGCCTCTGAGCTGGGG - Intronic
1170555714 20:17513238-17513260 TAGTGGAGGGCTCTGAGAAGGGG - Intronic
1170610684 20:17910435-17910457 GAGAGGAGGGCTCTAGGCTGAGG - Intergenic
1170910991 20:20567982-20568004 CAGTGCTGGACTCTGTGCTGGGG - Intronic
1171413249 20:24960430-24960452 CTCTGGAGGGCTCTGGGGAGCGG - Intergenic
1171977809 20:31606537-31606559 GAGGGGAGGGGCCTGGGCTGGGG + Intergenic
1172067401 20:32231210-32231232 CGGAGGAGGCCTCTGAGCTGGGG - Intronic
1172125359 20:32622328-32622350 CTATGGAGGGCTCTGAGCAGGGG + Intergenic
1172282262 20:33716296-33716318 CAGAGGAGGGCCCTGGGGTGAGG - Intronic
1172646050 20:36470297-36470319 CACTGTGGGGCTCTGGGGTGTGG - Intronic
1172777435 20:37415626-37415648 CAGTGGAGTGTGCTGGGCCGCGG + Intergenic
1172874460 20:38155910-38155932 CAGTGGAGGCCTCCAGGCTGAGG + Exonic
1173494482 20:43508639-43508661 ATGTGCACGGCTCTGGGCTGGGG + Intronic
1173642681 20:44614943-44614965 AAGTGGAGGGACCTGGGCTAGGG - Intronic
1173666346 20:44766062-44766084 GAGTGGAGGGCACTGTGGTGGGG + Intronic
1173688865 20:44943298-44943320 CAGAGCAGGCCTGTGGGCTGGGG - Intronic
1173790356 20:45824144-45824166 CAGGGCAGGGCTCAGGGCCGGGG + Intronic
1174062116 20:47840107-47840129 CAGTGCAGGGCTCCGCGTTGGGG - Intergenic
1174363232 20:50041236-50041258 CCCTGGAGGGCTCTGAGCAGAGG - Intergenic
1174403392 20:50288452-50288474 CATTGGAGGGCTCTGGGCACAGG + Intergenic
1174487551 20:50870875-50870897 CAGAGGCGGGCCTTGGGCTGGGG + Intronic
1174533981 20:51236889-51236911 CACTGGAGGGCTCTGAGCAGAGG + Intergenic
1175053806 20:56179214-56179236 CTGTGGATGACTCTGGGCTTTGG + Intergenic
1175818539 20:61896228-61896250 CAGATGAGGACTCTGGGCTCCGG + Intronic
1175855675 20:62119718-62119740 AAGTGGAGGGCACTTGGGTGAGG - Intergenic
1175893745 20:62327045-62327067 CAGCACAGGGCTCTGTGCTGGGG - Intronic
1175997197 20:62817190-62817212 GAGTGGCGGGTTCGGGGCTGGGG - Intronic
1176025184 20:62982066-62982088 CAGCAGAGGGCTCTGGGCATTGG + Intergenic
1176092789 20:63326346-63326368 CAAGTGAGGGCTCTGTGCTGAGG + Intronic
1176371125 21:6061861-6061883 CGCTGGAAGGCTCTGGGCGGTGG - Intergenic
1178316511 21:31570838-31570860 CAGAGGAGGTCTCTGCCCTGAGG - Intergenic
1178358079 21:31924801-31924823 CCGTGGGTGGCACTGGGCTGTGG + Intronic
1179513789 21:41892556-41892578 GTTTGGAGGGCTCGGGGCTGAGG - Intronic
1179752394 21:43476680-43476702 CGCTGGAAGGCTCTGGGCGGTGG + Intergenic
1179952566 21:44718389-44718411 CAGTGGAGAGGGGTGGGCTGTGG - Intergenic
1179990808 21:44947408-44947430 CAGGGGAGGGGTCTAGGCTGTGG + Intronic
1180746841 22:18095185-18095207 CAGGGGAGGGCTCTGTGCTTTGG + Exonic
1180816274 22:18791639-18791661 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
1181055687 22:20259596-20259618 GCTTGGAGGGCTCTGGGTTGGGG - Intronic
1181202463 22:21225971-21225993 CAGTGCCAGGCTCTAGGCTGGGG - Intronic
1181342517 22:22194013-22194035 CAGTGAAGGGATCAGGGCTGAGG - Intergenic
1181689201 22:24549031-24549053 GAGTGGTGGGCTCTGCGCTGAGG - Intronic
1181699244 22:24610643-24610665 CAGTGCCAGGCTCTAGGCTGGGG + Intronic
1181778458 22:25176634-25176656 CAGTGAAGTGCTCAGAGCTGGGG - Intronic
1182248156 22:28977184-28977206 CTGTGGAGTTCTCTCGGCTGAGG - Intronic
1182698010 22:32209287-32209309 CAGTGCAGGGTCCTGGCCTGAGG + Intergenic
1182958788 22:34452822-34452844 CCCCAGAGGGCTCTGGGCTGGGG - Intergenic
1182992873 22:34784655-34784677 CAGTGTAGGGCTCTGGAATTTGG - Intergenic
1183132444 22:35851772-35851794 CAGTGGCGGGATCTCGGCTGCGG - Intronic
1183350147 22:37330457-37330479 CAGTGGTGGCTTCTGGGCTGAGG + Intergenic
1183352744 22:37343196-37343218 CAGAGGAAGGAGCTGGGCTGAGG - Intergenic
1183709183 22:39492405-39492427 AAGTGGAGGATGCTGGGCTGAGG + Intergenic
1183745504 22:39689346-39689368 AAGCGGAAGGCTCTGAGCTGAGG - Exonic
1183957630 22:41391196-41391218 ACCTGGAGGGCTCTGGGCAGAGG - Intronic
1183991696 22:41601213-41601235 GAGGGGTGGGCTCTGGGATGTGG + Intronic
1184104906 22:42361861-42361883 CATTGCAGAGCTCTGGGCAGAGG + Intergenic
1184552435 22:45211595-45211617 CAAGGGAGGGCCCTGGGCTCTGG + Intronic
1184645459 22:45892470-45892492 CTGGGCAGGGCCCTGGGCTGCGG + Intergenic
1184651197 22:45920175-45920197 CAGGGGTGGGCTCTGGGCAAGGG + Intergenic
1185088820 22:48754888-48754910 CAGTGCAGGACCCTGGGGTGGGG - Intronic
1185246759 22:49776860-49776882 CACCGAGGGGCTCTGGGCTGTGG - Intronic
1185259285 22:49852975-49852997 CAGGGGCGGGCTCCGGGCAGAGG + Intergenic
1185279943 22:49965711-49965733 GGGTGCAGGGCGCTGGGCTGAGG + Intergenic
1185288322 22:50012113-50012135 CAGTGGAGGTGGCTGGGTTGGGG - Intronic
1203224450 22_KI270731v1_random:69442-69464 CAGTGCCAGGCTCTAGGCTGGGG + Intergenic
1203266377 22_KI270734v1_random:17350-17372 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
949948144 3:9206715-9206737 CAAAGGAGGCCTCTGGGGTGAGG - Intronic
950008686 3:9706985-9707007 CACTGGAGGGTTCTGAGCGGAGG + Intronic
950017037 3:9761608-9761630 GTGCGGAGGGCCCTGGGCTGGGG - Intronic
950201107 3:11044775-11044797 TAGTGGAAGGATCTGGGCTCAGG - Intergenic
950212358 3:11133208-11133230 CAGAGGAGGGCTATGATCTGGGG + Intergenic
950432120 3:12956821-12956843 GAGTGGAGGGCACTTGCCTGGGG - Intronic
950769948 3:15303347-15303369 GTGTGGCAGGCTCTGGGCTGGGG - Intronic
951527275 3:23665480-23665502 GCGTGGAGGACCCTGGGCTGTGG - Intergenic
951753473 3:26062769-26062791 CAGTTGAGAGTTGTGGGCTGAGG - Intergenic
951867970 3:27328667-27328689 CACTGGAAGGCTCTGGGGAGAGG + Intronic
952585821 3:34890701-34890723 CAGTGTAGGTCTCTGGTCAGAGG + Intergenic
952850214 3:37721962-37721984 CACTGGAGGGTTCTGAGCAGGGG - Intronic
953390304 3:42530031-42530053 GAGTGGAGGGCTGTGGACTGTGG - Intronic
953831503 3:46301554-46301576 TAGTAGAGGGCTCTGGGTAGTGG - Intergenic
954449775 3:50565570-50565592 AGGTGGTGGCCTCTGGGCTGAGG + Exonic
954456397 3:50601956-50601978 CAGTGGATGGCTGTGGGAGGAGG - Intergenic
954687132 3:52377103-52377125 CATGGGAGAGGTCTGGGCTGAGG - Intronic
954700006 3:52446078-52446100 GAGTGTAGGGTTCTGGGGTGGGG - Intergenic
955492727 3:59499364-59499386 CCGTGCACGGCACTGGGCTGAGG + Intergenic
957784148 3:84859562-84859584 CAGTGTAAGGATCTGGGCGGTGG + Intergenic
959524038 3:107355979-107356001 CAGTGGTGGGCTCTGGCATTAGG + Intergenic
960940825 3:122932670-122932692 CAGTGGTGGGCTCTGGCATTAGG + Intronic
961371535 3:126434703-126434725 CAGTGGAGGGCTTTAAGCAGTGG + Intronic
961451184 3:127003024-127003046 CCGTGGTGGGTGCTGGGCTGTGG + Intronic
961459693 3:127042626-127042648 CAGTGGAGGGGGCTGGGAAGTGG - Intergenic
961599902 3:128052464-128052486 CAGTGGAACGCGCTGGGCCGCGG + Exonic
961603647 3:128078086-128078108 CTCTGGAGGGCTGTGGGCAGAGG - Intronic
961658928 3:128458120-128458142 CAGAGCAGGGCTCTGGGTGGAGG + Intergenic
961741238 3:129034276-129034298 CAGCTGAGGACTCAGGGCTGCGG + Exonic
961742212 3:129039993-129040015 CAATGGGAGGCTCTGGGCTCGGG - Exonic
963231617 3:142914197-142914219 CAAGGGAGGGCTAAGGGCTGAGG - Intergenic
966208440 3:177428153-177428175 CTGTGCAGGGGGCTGGGCTGGGG + Intergenic
967009823 3:185422262-185422284 TAGTGGAAGGAGCTGGGCTGAGG + Intronic
967523976 3:190470934-190470956 CAGCAGAGTTCTCTGGGCTGGGG - Intergenic
967742712 3:193020973-193020995 CTGTGGTGGGGTCTGAGCTGTGG + Intergenic
967839260 3:193991626-193991648 CAGAGGAGGGATATAGGCTGTGG - Intergenic
968190080 3:196661046-196661068 CTCTGGAGGGCTGTGGCCTGGGG + Exonic
968271722 3:197408225-197408247 GAGTGGAGGGCTATGCCCTGGGG + Intergenic
968502050 4:955367-955389 CTGTGGAGGGCACTGACCTGCGG + Intronic
968747928 4:2370594-2370616 CACTGGTGGGCTCTGGGCCCTGG - Intronic
968830325 4:2930313-2930335 ATGGGGAGGGCTCTGTGCTGGGG + Intergenic
968954118 4:3709572-3709594 CAGTGCCTGGCTCTGGGCTAGGG + Intergenic
968954640 4:3712010-3712032 TAGGGGAGCGCACTGGGCTGAGG - Intergenic
968964067 4:3760631-3760653 CAGTGAAGGGCTGTGGGTTGAGG + Intergenic
969311402 4:6354810-6354832 CTGTGGGGGGCTGTGGGCGGAGG - Intronic
969719403 4:8885046-8885068 CTGTGGAGGTATCTGGGGTGGGG + Intergenic
970195252 4:13545083-13545105 CAGTGGAGGGGTGTGGCCTCAGG - Intergenic
972541560 4:40043603-40043625 CAGTGTTCGGCTCTGGGTTGAGG + Intergenic
973647556 4:52965345-52965367 GAACTGAGGGCTCTGGGCTGAGG - Intronic
975334337 4:73158226-73158248 CAGTGGAGGGTTCTGAGTAGAGG - Intronic
976331637 4:83838486-83838508 CAGTGGCGGGATCTCGGCTCAGG - Intergenic
976514900 4:85953993-85954015 CAGTGGAGGGCTCTGAAATCTGG + Intronic
977422620 4:96821963-96821985 CAGTGGGTGGCACTGTGCTGAGG - Intergenic
978360479 4:107926106-107926128 CTGTGGAGGGGTTGGGGCTGGGG + Intergenic
979275023 4:118805874-118805896 CAGGGGAGGGATCTGGCCTCTGG + Exonic
979311861 4:119212670-119212692 CAGGGTCGGGCTCTGGGCGGCGG + Intronic
980318710 4:131239797-131239819 CAGAGGAGGGGTCTGGTCGGAGG + Intergenic
980730000 4:136812375-136812397 CAGGAGAAGACTCTGGGCTGGGG - Intergenic
983720946 4:170850695-170850717 AAGTGGAGGGATTTGGGTTGAGG + Intergenic
983753180 4:171301692-171301714 CAGTGGGGGGCTGTGGGTTAAGG + Intergenic
985088435 4:186339450-186339472 CAGTGGAGGCCTAAGGACTGAGG - Intergenic
985764129 5:1768028-1768050 CAGTCTGGGGCCCTGGGCTGAGG + Intergenic
986116643 5:4781841-4781863 CAATGGAGGGATCTGTGCAGAGG + Intergenic
988228761 5:28448065-28448087 CAGTGGAGGCCTCTAGGATTTGG + Intergenic
988448970 5:31320612-31320634 CACTGCAGGGCTTTGGGCAGAGG - Intronic
988672279 5:33394705-33394727 CTGTTGAGGGCTGTGGGCTGGGG + Intergenic
988728923 5:33950734-33950756 CAATTCAGGGCTCTGGGCTTTGG - Intronic
989453419 5:41613620-41613642 CATTGGAGGGTTCTGGGCACAGG - Intergenic
989522720 5:42420590-42420612 CATTGGAGGGTTTTGAGCTGAGG + Intergenic
989527556 5:42470675-42470697 CAGTGTAGGGCTAGGGGCTGCGG - Intronic
992653503 5:78885340-78885362 CCATGGAGGGCGATGGGCTGAGG + Intronic
995069570 5:107904089-107904111 CAGTGGAGAGCTCTGGAAAGGGG - Intronic
997465813 5:134087417-134087439 CAGTGGAGGGGGTTGGGCTGTGG - Intergenic
997980932 5:138466997-138467019 CAGGGGTGGGCTCTGGGAGGCGG - Exonic
999133979 5:149305495-149305517 CATTGGAGTGGGCTGGGCTGAGG - Intronic
999262815 5:150247974-150247996 GAGGGATGGGCTCTGGGCTGGGG - Intronic
999308238 5:150534695-150534717 GAATTCAGGGCTCTGGGCTGGGG + Intronic
999328413 5:150657199-150657221 CAGAGGAGAGCTCTGGGGTTGGG + Intronic
1000050929 5:157562393-157562415 CAGAGGAGAGCCCGGGGCTGTGG - Intronic
1000234167 5:159342293-159342315 CAGGGGAGGGCTCTCTGATGAGG + Intergenic
1001296312 5:170501778-170501800 CAGAGGAGAGCTCTTTGCTGAGG - Intronic
1001475632 5:172048766-172048788 CACTGGAGGGTTCTGAGCAGAGG - Intronic
1001567844 5:172712029-172712051 TATTGGAGGGTTCTGAGCTGGGG - Intergenic
1001600040 5:172922777-172922799 CCGTGGAGGGTTCTGGGCAGAGG + Intronic
1001990734 5:176113642-176113664 CAGGGGAGGGGGCTGGGCTGGGG + Intronic
1002226139 5:177724498-177724520 CAGGGGAGGGGGCTGGGCTGGGG - Intronic
1002267710 5:178046715-178046737 CAGGGGAAGGGGCTGGGCTGGGG + Intronic
1003162898 6:3651224-3651246 GAGTGGTTTGCTCTGGGCTGTGG - Intergenic
1003488238 6:6597793-6597815 GAGTGGAGATTTCTGGGCTGGGG - Intronic
1004673587 6:17820343-17820365 CGGTGGAGGTCTAGGGGCTGGGG + Intronic
1005806068 6:29475524-29475546 CAGAGGTGTGCTCTGGGCGGTGG + Intergenic
1006819432 6:36879952-36879974 CAGTAGACTGCTCTGTGCTGTGG + Intronic
1006838472 6:37013562-37013584 GAGAGGAGGTCTCTAGGCTGAGG + Intronic
1007095992 6:39213560-39213582 AACTGGTGGGCTCTGGCCTGTGG - Intronic
1007153297 6:39717148-39717170 CAATGGAGGGCTTTGAGCAGAGG - Intronic
1007217619 6:40252621-40252643 CAGTGATGAGCTGTGGGCTGGGG - Intergenic
1007953238 6:45891728-45891750 CAGTGGTGAGCTCTGGGAAGGGG + Intergenic
1008195276 6:48511509-48511531 CACTAGAGGGCTGTGGGCAGAGG - Intergenic
1010198147 6:73260272-73260294 AAGGGGAAGGCTCTGGGCTGGGG + Intronic
1010893952 6:81344030-81344052 CAGTGAAGGGAGATGGGCTGGGG + Intergenic
1011276966 6:85641940-85641962 CAGGGGCGGGCTTTGGGGTGCGG - Intronic
1014098285 6:117482935-117482957 CAGGGGCGGGCTGAGGGCTGCGG + Intronic
1016022863 6:139254493-139254515 CAGTGGAAGTCTGTGGCCTGTGG + Intronic
1016990130 6:149922864-149922886 CCGTGGGGGGCTGTGGACTGTGG - Intronic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1017967417 6:159278322-159278344 CAGTGGGGGGATCTGTGCTCAGG + Intergenic
1018232465 6:161688748-161688770 CAGTGAAGGTCCATGGGCTGAGG + Intronic
1018420449 6:163636179-163636201 CTCTGGGAGGCTCTGGGCTGGGG + Intergenic
1018969708 6:168517827-168517849 CGGTGGAGGGGCCTGGGCGGTGG + Intronic
1019121032 6:169803667-169803689 CAGTAGAGAGCTCTGTGTTGAGG - Intergenic
1019121132 6:169804910-169804932 CTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019121279 6:169806703-169806725 CTGTGGAGTGCTCTGTGTTGTGG - Intergenic
1019121356 6:169807736-169807758 CTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019388683 7:773332-773354 CGCTGGAGGGCTGCGGGCTGTGG + Intronic
1019404543 7:876821-876843 CGGGGGCGGGCGCTGGGCTGCGG - Intronic
1019449411 7:1089411-1089433 CAGTGGTGTGATCTCGGCTGAGG + Intronic
1019449414 7:1089442-1089464 CAGTGGTGTGATCTCGGCTGAGG + Intronic
1019471575 7:1224140-1224162 GAGTGGGGGGCCCAGGGCTGCGG - Intergenic
1019490486 7:1311044-1311066 CTGTGGAGGGTGCTGGGCTGCGG - Intergenic
1019504774 7:1385402-1385424 CAGTGGCCGGGTCTGAGCTGGGG - Intergenic
1019517875 7:1447644-1447666 TAGTGGAGGCTTCCGGGCTGGGG + Exonic
1019569827 7:1705698-1705720 CAGTGGATGGCTTTGGGCCTCGG + Intronic
1019575216 7:1734522-1734544 GCGGGGAGGGCTCAGGGCTGGGG - Intronic
1019732170 7:2634375-2634397 CAGTGGGTGGGCCTGGGCTGTGG + Intronic
1019809952 7:3158037-3158059 CTGTGGTGGGGTCTGTGCTGGGG - Intronic
1020344442 7:7147972-7147994 CATTGGAGGGTTTTGAGCTGAGG - Intergenic
1021597306 7:22331012-22331034 CAGTGGAGGGCTGTGGGGCAGGG - Intronic
1021926022 7:25534611-25534633 CAGTGGTGGGCTCTGGGGGGAGG - Intergenic
1022112535 7:27240267-27240289 CTGGGGAAGGCTTTGGGCTGAGG + Intergenic
1022518336 7:30989519-30989541 CACTGAGGGGCTCTGGGCTCTGG - Intronic
1022560088 7:31338614-31338636 GAGTGGTGAGCTCAGGGCTGTGG + Exonic
1023604609 7:41918106-41918128 AAGTGGTGGTCTCTGGGCTGCGG + Intergenic
1023872319 7:44269669-44269691 CACTGCAGGGCACTGGGCGGGGG + Intronic
1025140717 7:56461181-56461203 CACTGGAGACCCCTGGGCTGGGG + Intergenic
1026362943 7:69619442-69619464 CACAGGAAGGCTCTGAGCTGTGG + Intronic
1028086162 7:86640140-86640162 CTGTGAAGGGCACAGGGCTGTGG - Intergenic
1029506475 7:100966441-100966463 CACTGGAGGGCGCTGGTCGGGGG + Exonic
1031856878 7:126933612-126933634 AAGTCAAGGGCTCTGTGCTGTGG + Intronic
1033755322 7:144394325-144394347 CAGTGGAGGGCCCGAGGCTTGGG - Intergenic
1034210651 7:149359229-149359251 CAGTGGGGAGGTGTGGGCTGTGG - Intergenic
1034461370 7:151199709-151199731 CTGAGGAGGGGGCTGGGCTGGGG - Intronic
1034901256 7:154909385-154909407 CAGAGGAGGGGACTGGGTTGGGG + Intergenic
1035159090 7:156938166-156938188 CAGAGGAGGCCTCTTGCCTGGGG + Intergenic
1035281191 7:157779510-157779532 ACGTGGAGGGCACTGGCCTGAGG - Intronic
1035388198 7:158488646-158488668 CAGGGCAGGGCGCTGGCCTGGGG - Intronic
1035638173 8:1162875-1162897 CAGAAGAGGGTGCTGGGCTGGGG + Intergenic
1035831205 8:2696535-2696557 CAGTGGCTGCCTCTGGACTGTGG + Intergenic
1037910897 8:22743039-22743061 CGGTGAAGGGCTGTGTGCTGGGG + Intronic
1038045385 8:23761560-23761582 CAGTGGAGGAATGGGGGCTGGGG + Intergenic
1038356165 8:26831477-26831499 CAGTGGTGGGGTGTGGGCAGGGG - Intronic
1038581802 8:28754276-28754298 CAGGAGAGGGCACTGAGCTGTGG + Intronic
1038612633 8:29069926-29069948 CTCTGGAGGGCCCTGGGCTCTGG - Exonic
1039894126 8:41704340-41704362 CAGTGCAGGAGTCGGGGCTGGGG + Intronic
1039922832 8:41905314-41905336 CAGTGGAGGGCCCGGGGGAGGGG - Intergenic
1040416931 8:47203465-47203487 CAGTGTGGGGCCCAGGGCTGAGG + Intergenic
1042201397 8:66282244-66282266 CACTGGAAGGCTCTAGGCAGTGG - Intergenic
1042693730 8:71532384-71532406 CAGCTCAGAGCTCTGGGCTGAGG - Intronic
1043147671 8:76677816-76677838 CAGTGGATGTGGCTGGGCTGGGG + Intergenic
1043750216 8:83925730-83925752 CAGTGCCTGGCTCTGTGCTGTGG - Intergenic
1044948075 8:97409642-97409664 AAGTGCTGGCCTCTGGGCTGTGG - Intergenic
1047152986 8:122285361-122285383 CATGGGAGGGCTTTGGGCTTTGG - Intergenic
1047522721 8:125607911-125607933 CAGGGGTAGGCTTTGGGCTGGGG + Intergenic
1048159697 8:132004258-132004280 CAGTACAGGTCTCTGGACTGAGG - Intronic
1048240801 8:132740060-132740082 CACTGGAGGATTCTGAGCTGAGG - Intronic
1048288196 8:133158785-133158807 GAGTGCAGGGCTCTTGCCTGTGG + Intergenic
1048306085 8:133285672-133285694 CACTGGGGTGCTCTGGTCTGGGG + Intronic
1048354228 8:133640396-133640418 CAGAGGAGGGTACTGGGCAGTGG + Intergenic
1048574871 8:135682522-135682544 CAGGGCAGGGGGCTGGGCTGAGG + Intergenic
1048970936 8:139644718-139644740 CAGTGGGAGGCTCTGGGGGGGGG - Intronic
1049201268 8:141341708-141341730 CACTGGAGGGGCCTGGGCTCAGG + Intergenic
1049210790 8:141385551-141385573 CAGTGAAGGTCCCTGAGCTGAGG - Intergenic
1049234651 8:141506514-141506536 GCGGGCAGGGCTCTGGGCTGGGG + Intergenic
1049364624 8:142231128-142231150 CAGTTGAGGGAGCTGAGCTGGGG - Intronic
1049418355 8:142505705-142505727 CGCTGGAGGGCTCTAAGCTGAGG + Intronic
1049561044 8:143310415-143310437 CAGAGGAGGGCCGTGGGCGGAGG + Intronic
1049624299 8:143613167-143613189 AAGTGGAGGGCTGTGGGGTCAGG + Intronic
1051166982 9:14273332-14273354 GAGTGGAAGACTCGGGGCTGTGG + Intronic
1052838263 9:33267622-33267644 TAGTTGAGGACTCTGGGATGTGG + Intronic
1052980316 9:34443728-34443750 CAGTGGGGGGCACGGGCCTGAGG - Intronic
1053016123 9:34663284-34663306 CTGAGGAGGGTTCTTGGCTGAGG + Intronic
1053447913 9:38167116-38167138 GAGTGAAGGGCTCAGGGCTTTGG + Intergenic
1053538138 9:38946376-38946398 GAGTTGAGGGCTCTGGGCTGTGG + Intergenic
1053555508 9:39132958-39132980 CAGCGGCTGGCTCTGCGCTGCGG - Exonic
1053711083 9:40808714-40808736 CAGTGGACGGTTGTGGGGTGGGG + Intergenic
1053819622 9:41953209-41953231 CAGCGGCTGGCTCTGCGCTGCGG - Exonic
1054420993 9:64929526-64929548 CAGTGGACGGTTGTGGGGTGGGG + Intergenic
1054627996 9:67417545-67417567 GAGTTGAGGGCTCTGGGCTGTGG - Intergenic
1054752733 9:68924879-68924901 CAGTGGATATCTCTGGGTTGTGG - Intronic
1055964203 9:81849650-81849672 CTGTGCTGGGCTCTGGGATGCGG + Intergenic
1057083646 9:92189900-92189922 CAGGGGCGGCCTCTGGGCTCAGG + Intergenic
1057191379 9:93089771-93089793 AAGGGAAGGGCTCTGGCCTGGGG - Intergenic
1057455580 9:95207005-95207027 CAGTGTGGGGCTGGGGGCTGGGG - Intronic
1057695760 9:97322014-97322036 CAGTGGAAGGTTCTGAGCTGGGG + Intronic
1059106343 9:111515018-111515040 CAGTGGATGGCTATGGGTGGGGG - Intergenic
1059460419 9:114426078-114426100 CAATGGAGGGCCCTGGTGTGGGG + Intronic
1059529544 9:115023253-115023275 CTGTGGAGGGACCTGGGCAGGGG + Intronic
1060087588 9:120715517-120715539 CACTGAAGGGCTGTGGCCTGGGG - Intergenic
1060195786 9:121622547-121622569 CAGTGGAGGGCTCCCGGCCATGG - Intronic
1060751761 9:126174181-126174203 AAGGGGAGAGCCCTGGGCTGAGG + Intergenic
1060795069 9:126507709-126507731 CAGAGCAGGGGTCTGGGATGTGG - Intergenic
1060807720 9:126588074-126588096 AGGTGGAGGGCTCTAGGCTCAGG + Intergenic
1060894910 9:127211327-127211349 CCGTGGAGCGCACTGGGCAGTGG + Intronic
1061085132 9:128393848-128393870 CAGTGGAAGCCCCTGGGCAGGGG - Intergenic
1061136172 9:128735199-128735221 AAGTGGAGGGTTCTGCTCTGAGG + Intronic
1061277872 9:129579755-129579777 CAATGGGGGGCTCTGAGCAGGGG + Intergenic
1061928833 9:133821837-133821859 GGGTGGAGGGAGCTGGGCTGGGG - Intronic
1062157221 9:135059073-135059095 CAGTGGATGGATCTGGGCCTGGG - Intergenic
1062267445 9:135693753-135693775 CAGTGGACTGCTCTCAGCTGGGG + Exonic
1062391698 9:136336412-136336434 CAGGGGGTGGCTCTGGGCTGCGG + Intronic
1062591388 9:137276326-137276348 CTGCAGAGGGCTCTGGCCTGAGG + Intergenic
1062646557 9:137551110-137551132 GAGGGGATGGATCTGGGCTGTGG + Intergenic
1062731302 9:138111689-138111711 CAGTGGAGGGTTTTGAGCAGAGG - Intronic
1062740730 9:138173783-138173805 CAGTGCAGGGGCCTTGGCTGTGG - Intergenic
1203369066 Un_KI270442v1:285801-285823 CAGTGCAGGGGCCTTGGCTGCGG + Intergenic
1185506382 X:634586-634608 GAGCGGAGGGCACAGGGCTGAGG - Intronic
1186630120 X:11339700-11339722 CAGAGGAGAGCTCAGAGCTGAGG - Intronic
1187497540 X:19808417-19808439 CAGAGGAAGGCTATGGTCTGAGG - Intronic
1187652255 X:21421804-21421826 CAGTCCAGGGTTCTGTGCTGGGG + Intronic
1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG + Intronic
1189165988 X:38861589-38861611 CAGTGGAGGGTTTTGAGCAGAGG + Intergenic
1189369779 X:40418533-40418555 GAGTGGTGAGCTCTGGACTGAGG - Intergenic
1191052817 X:56212639-56212661 CAGTGGTGGCCTCTGGGCATTGG - Intergenic
1195094612 X:101492150-101492172 CAGTGGAGGGCTCTGGGCTGGGG + Exonic
1195094630 X:101492210-101492232 CAGTGGAGGAGCCTGGACTGGGG + Exonic
1195094649 X:101492282-101492304 CATTGGAGAGCTTTGGGCTGCGG + Exonic
1195094681 X:101492372-101492394 CATTGGAGGGTCCTGGACTGGGG + Exonic
1195094818 X:101492924-101492946 CAATGGAGGGTCCTGGACTGGGG + Exonic
1199533865 X:148880036-148880058 CAGTGGTTGGCACTGGGCTAGGG + Intronic
1199952219 X:152715518-152715540 GAGTTGAGGGCTGTGGTCTGAGG + Intronic
1199957464 X:152752930-152752952 GAGTTGAGGGCTGTGGTCTGAGG - Intronic
1200217273 X:154373601-154373623 CAGTGGGAGGGTCTGGCCTGGGG - Intronic
1200753579 Y:6969158-6969180 CTGTGGACTTCTCTGGGCTGTGG + Intronic