ID: 1195095235

View in Genome Browser
Species Human (GRCh38)
Location X:101495050-101495072
Sequence AACCATATGCTGATATTCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195095235_1195095239 24 Left 1195095235 X:101495050-101495072 CCAGTGAATATCAGCATATGGTT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1195095239 X:101495097-101495119 CGTTTGTTAACGGTGGGAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 57
1195095235_1195095238 18 Left 1195095235 X:101495050-101495072 CCAGTGAATATCAGCATATGGTT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1195095238 X:101495091-101495113 TTTCTTCGTTTGTTAACGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 115
1195095235_1195095237 17 Left 1195095235 X:101495050-101495072 CCAGTGAATATCAGCATATGGTT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1195095237 X:101495090-101495112 ATTTCTTCGTTTGTTAACGGTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1195095235_1195095236 14 Left 1195095235 X:101495050-101495072 CCAGTGAATATCAGCATATGGTT 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1195095236 X:101495087-101495109 AGAATTTCTTCGTTTGTTAACGG 0: 1
1: 0
2: 1
3: 25
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195095235 Original CRISPR AACCATATGCTGATATTCAC TGG (reversed) Exonic
907881595 1:58554459-58554481 AAACATATGTAGATATTTACAGG - Intergenic
908789617 1:67768869-67768891 AAGCATATGGTGATTTGCACTGG - Intronic
908794849 1:67820791-67820813 TAGCATATGCTGATACTCAAAGG + Intronic
911776887 1:101825245-101825267 AACAATAGGCTGCTTTTCACAGG - Exonic
916166009 1:161968080-161968102 CACCCTATTCAGATATTCACAGG + Intergenic
917177524 1:172253312-172253334 AACCACATGTTGAGAATCACTGG + Intronic
918485927 1:185027975-185027997 CAGCATATGCTTATATTCATGGG - Intergenic
919592229 1:199519146-199519168 AATCATATTCTAAAATTCACTGG - Intergenic
923392291 1:233524867-233524889 AACATTATGCTGATAGTCATAGG + Intergenic
924402379 1:243699696-243699718 TACCATAAGGTAATATTCACAGG - Intronic
1065015736 10:21461145-21461167 GATCATATGCAGATTTTCACTGG + Intergenic
1067376181 10:45729365-45729387 AACCATATGCTGGTGTCCAGAGG - Intronic
1067883881 10:50070050-50070072 AACCATATGCTGGTGTCCAGAGG - Intronic
1075591780 10:123696946-123696968 ACCCATATGCATATAATCACGGG - Intergenic
1086259534 11:84922584-84922606 AATCATTTGTTGATATGCACAGG + Intronic
1089166871 11:116484105-116484127 AACCATCTGCTCAGAATCACCGG + Intergenic
1092358989 12:7820229-7820251 AACCAGATGAAGAGATTCACAGG - Intronic
1092372109 12:7925157-7925179 AACCAGATGAAGAGATTCACGGG - Intronic
1094744137 12:33324124-33324146 AGCCATAAGCTATTATTCACTGG + Intergenic
1094784515 12:33830889-33830911 AACCATATTCTGGAATTCACGGG + Intergenic
1095542279 12:43324564-43324586 AACCATATCATCATATTCAAGGG - Intergenic
1097102965 12:56602216-56602238 AGCCATATGCTGACATACAAGGG + Intronic
1097552118 12:61086950-61086972 AACCATATTCTGCTATGCACAGG - Intergenic
1103973172 12:124685134-124685156 AACAATATTCTGGTTTTCACTGG - Intergenic
1111174013 13:84568402-84568424 AATCATCTGCTAATATTTACTGG - Intergenic
1114570628 14:23664875-23664897 GACCATTTGCTGATACTCATTGG - Intergenic
1117240762 14:53829976-53829998 AACCAAGTGCTGGTATCCACAGG + Intergenic
1120451413 14:84671928-84671950 CTCCATCTGCTGCTATTCACAGG - Intergenic
1121168215 14:91829817-91829839 AAACAAATGCAGATATTCTCTGG - Intronic
1123670725 15:22654294-22654316 ACCCATATGATGATATTTGCAGG + Intergenic
1124526699 15:30460719-30460741 ACCCATATGATGATATTTGCAGG + Intergenic
1124771954 15:32546964-32546986 ACCCATATGATGATATTTGCAGG - Intergenic
1129069819 15:72941414-72941436 AAACATATGCTGTTATTATCAGG + Intergenic
1130399336 15:83534497-83534519 GACCTGATTCTGATATTCACAGG + Intronic
1131021331 15:89101773-89101795 AACCATACAAAGATATTCACTGG - Intronic
1133909720 16:10054189-10054211 AACTATAAGCTGATCTTCAGAGG + Intronic
1134398644 16:13888928-13888950 CACCAGATGCTGATATTTCCTGG - Intergenic
1136525052 16:30824176-30824198 AACCATGTCCTGATACTCATTGG + Intergenic
1143077839 17:4360486-4360508 AACAATATAATGATAGTCACTGG + Intronic
1153072571 18:1122740-1122762 AACAAAATGCTGAGATTCATTGG - Intergenic
1159085765 18:63789912-63789934 AATCAAATGCTGATGTTCCCAGG + Intronic
1159362285 18:67420953-67420975 AACCATATGCTTATTTTTAAAGG + Intergenic
1163230874 19:16001317-16001339 CACCATACGCTGATTTTCAGTGG + Intergenic
1163958720 19:20667151-20667173 AATCAGATGCTGATATTGAGGGG + Intronic
1164003435 19:21128000-21128022 AACCAGAAGCTGATATCCACCGG + Intergenic
1164136367 19:22420453-22420475 AATCACATGCTGATATTGAGGGG - Intronic
1168199144 19:54801540-54801562 CACCATATGTTGCTATTAACTGG - Intronic
929379534 2:41334145-41334167 AAAGAAATGCTCATATTCACTGG + Intergenic
929638554 2:43551124-43551146 AACCATATGCTGAAATACCTTGG - Intronic
933042247 2:77484144-77484166 AAACAAATGCTGGCATTCACAGG + Intronic
933525702 2:83435819-83435841 GACCATATGTTGATAATAACTGG - Intergenic
933891340 2:86773578-86773600 AGCCCTATGATAATATTCACCGG - Exonic
936668756 2:114631066-114631088 AACTATATGCTGATAAACTCTGG - Intronic
937041595 2:118825165-118825187 CACCACATGCTGACATTCAGGGG - Intergenic
939039570 2:137171994-137172016 AATTATATGTTAATATTCACAGG - Intronic
939761082 2:146180487-146180509 AACCATATACTCAGATTCAATGG + Intergenic
940980814 2:160000457-160000479 AAACAAATGCTAATTTTCACTGG + Intronic
943977119 2:194497218-194497240 AACAATATTCTGAGATTCAGTGG + Intergenic
1173321808 20:41994359-41994381 ACACATATTCTGATATTCAGCGG + Intergenic
1177063309 21:16398696-16398718 AAATATATCCTGATATTTACAGG + Intergenic
1177233293 21:18351011-18351033 AACCATATTTTGATATTCTAGGG + Intronic
1177279291 21:18959147-18959169 TAGCATATGCTGATATTTTCTGG - Intergenic
1179527123 21:41987070-41987092 AACCATAAGCATATATTCAATGG + Exonic
1183918909 22:41147815-41147837 AACATTTTGCTCATATTCACAGG + Exonic
1185306315 22:50119182-50119204 CACAATATGTTAATATTCACGGG - Intronic
949103425 3:174238-174260 AACCAGATTCTGATTTTCTCAGG - Intergenic
956067276 3:65410453-65410475 AACTATATGCTGTCATTCAAAGG + Intronic
956972948 3:74548434-74548456 AACCATATGCCTATATTAAATGG - Intergenic
958149038 3:89666264-89666286 AATCATATGATCATATTCATAGG - Intergenic
959787410 3:110316974-110316996 AACCATATTCTGATATTAGTGGG - Intergenic
960183954 3:114616040-114616062 ATCATTATGCTGTTATTCACTGG + Intronic
962301507 3:134247735-134247757 AACTATATGCATATATTAACTGG + Intronic
972245154 4:37238758-37238780 AGCCATATGCAGAAATTGACAGG - Intergenic
972804158 4:42510466-42510488 AGCTATATCCTGATCTTCACTGG - Intronic
974489068 4:62541012-62541034 AATCACATGCTCATATTAACAGG + Intergenic
976029566 4:80735680-80735702 AACCATATGATCATTTTGACTGG - Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
980724027 4:136734969-136734991 AACCATATGGTGATCCTGACAGG - Intergenic
981477239 4:145199256-145199278 TGCCATATGCTAATAATCACTGG - Intergenic
982934633 4:161456851-161456873 AACCATTTACTGACATTCAAGGG + Intronic
984400008 4:179251226-179251248 ACCCCTATGCTTATATCCACTGG - Intergenic
987828524 5:23064474-23064496 AACCATAAGCTGTTTTTCCCCGG + Intergenic
988364873 5:30284418-30284440 AATTATATGCTCAAATTCACTGG + Intergenic
988918405 5:35919116-35919138 AACTATATAGAGATATTCACTGG + Intronic
994149477 5:96432045-96432067 AACAATAAGCTGAAATTCCCGGG + Intronic
996034636 5:118744924-118744946 AACCTTATACTGATATATACAGG + Intergenic
998659269 5:144218154-144218176 GACCATATGCTTCTGTTCACAGG - Intronic
999083938 5:148870535-148870557 AATCAGATTCTGATATTCTCTGG + Intergenic
1000447566 5:161342757-161342779 AACCATATTCTGATTTTTAGTGG + Intronic
1002695220 5:181083694-181083716 CACCAAATGCTGACATGCACGGG + Intergenic
1002702955 5:181139206-181139228 AACTATATACTGCTATTAACAGG - Intergenic
1005072289 6:21873014-21873036 AAGCATATGTTGAAACTCACTGG - Intergenic
1006964146 6:37964970-37964992 CACAATAAGCTAATATTCACTGG - Intronic
1008741310 6:54612217-54612239 ACCAATATTCTGATATTAACTGG - Intergenic
1011984425 6:93424812-93424834 AGACATTTGCTGATATTCAAAGG + Intergenic
1016689107 6:146915260-146915282 AACGATATGCTGATAAGCATAGG + Intergenic
1018217599 6:161545269-161545291 AACCACATCCTGATAATCACTGG + Intronic
1018587609 6:165379310-165379332 AAGCACCTGCTCATATTCACTGG + Exonic
1018640272 6:165898536-165898558 GACCACATGCTGATCTCCACAGG - Intronic
1019779481 7:2930989-2931011 AACCATATGCTGTCCTTCCCTGG + Intronic
1023852971 7:44160418-44160440 AGCCACCTGCTGATATTCATTGG + Intronic
1025802118 7:64796101-64796123 AATCATATGCTGGTATTGAGGGG + Intronic
1027860421 7:83571469-83571491 AACCATATGATCATCTTCACAGG + Intronic
1030105075 7:105980362-105980384 ATCTATATGCTGATGTTCAAGGG - Intronic
1033154370 7:138944113-138944135 TACCATATACTGTTATTAACTGG + Intronic
1034648750 7:152672658-152672680 AAGAATGTGCAGATATTCACAGG + Intronic
1036166094 8:6435069-6435091 AACCCCAGGCTGATATCCACAGG - Intronic
1037860762 8:22403990-22404012 AGGCATGAGCTGATATTCACTGG - Intronic
1041844235 8:62308957-62308979 AACCATGTGTTGATATTTAAAGG + Intronic
1046275584 8:111955699-111955721 AACCATATGTGGACATTCCCAGG + Intergenic
1048028658 8:130610313-130610335 ATCTATATGCTGATGTTCAAGGG + Intergenic
1049110112 8:140636880-140636902 AACAGTGTGCTCATATTCACAGG + Intergenic
1052167675 9:25353018-25353040 AAGCATATGCAGATCTTCAAAGG + Intergenic
1052506741 9:29364576-29364598 AACCACATGCTAATAAGCACAGG + Intergenic
1055995393 9:82152319-82152341 AACCTTATACTGTTAATCACTGG - Intergenic
1058038323 9:100277327-100277349 AACAATCTGGTGATGTTCACGGG - Intronic
1059945336 9:119403770-119403792 CACCATATGTTGACAATCACTGG + Intergenic
1061491419 9:130946858-130946880 AACCATATGATGAAATACACGGG - Intergenic
1062208282 9:135349127-135349149 CACCAGATCCTGATATTCTCGGG - Intergenic
1186328253 X:8503448-8503470 AACCATCTGTTTATATTCATGGG + Intergenic
1190126102 X:47707153-47707175 AACTAGTTGCTGATATTCAGGGG - Intergenic
1192072492 X:67956004-67956026 AGCCAGATCATGATATTCACTGG + Intergenic
1192072604 X:67957093-67957115 AGCCAGATCATGATATTCACTGG + Intergenic
1192807485 X:74523244-74523266 TTCCATCTGCTGGTATTCACTGG - Intronic
1193545854 X:82827916-82827938 AAGCTGATGCTGATATTCAGTGG + Intergenic
1194939598 X:99994040-99994062 AACCATATGCTGGTATTTCTTGG + Intergenic
1195095235 X:101495050-101495072 AACCATATGCTGATATTCACTGG - Exonic
1195623822 X:106986825-106986847 AACTGTTTGCTGATATTCAGAGG - Intronic
1199317455 X:146396879-146396901 AACCATATGATCATCTTAACAGG - Intergenic
1201400725 Y:13601065-13601087 CAGCATCTGCTGATATTCAGAGG - Intergenic
1201433888 Y:13935334-13935356 AACCATCTGCTTATATTCATGGG - Intergenic