ID: 1195098790

View in Genome Browser
Species Human (GRCh38)
Location X:101532932-101532954
Sequence TATTCTCCCAACAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195098790_1195098796 15 Left 1195098790 X:101532932-101532954 CCTGCCTCCCTGTTGGGAGAATA 0: 1
1: 0
2: 1
3: 17
4: 140
Right 1195098796 X:101532970-101532992 ATGCTGAATGTGAAAGGAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 271
1195098790_1195098794 9 Left 1195098790 X:101532932-101532954 CCTGCCTCCCTGTTGGGAGAATA 0: 1
1: 0
2: 1
3: 17
4: 140
Right 1195098794 X:101532964-101532986 GAATAGATGCTGAATGTGAAAGG 0: 1
1: 0
2: 1
3: 21
4: 262
1195098790_1195098798 24 Left 1195098790 X:101532932-101532954 CCTGCCTCCCTGTTGGGAGAATA 0: 1
1: 0
2: 1
3: 17
4: 140
Right 1195098798 X:101532979-101533001 GTGAAAGGAGTGGGCCATGGTGG 0: 1
1: 1
2: 3
3: 32
4: 290
1195098790_1195098797 21 Left 1195098790 X:101532932-101532954 CCTGCCTCCCTGTTGGGAGAATA 0: 1
1: 0
2: 1
3: 17
4: 140
Right 1195098797 X:101532976-101532998 AATGTGAAAGGAGTGGGCCATGG 0: 1
1: 0
2: 3
3: 23
4: 258
1195098790_1195098795 14 Left 1195098790 X:101532932-101532954 CCTGCCTCCCTGTTGGGAGAATA 0: 1
1: 0
2: 1
3: 17
4: 140
Right 1195098795 X:101532969-101532991 GATGCTGAATGTGAAAGGAGTGG 0: 1
1: 0
2: 0
3: 34
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195098790 Original CRISPR TATTCTCCCAACAGGGAGGC AGG (reversed) Intronic
900505207 1:3026898-3026920 TATGCTCCCAATAGGGAAACAGG - Intergenic
904533365 1:31183167-31183189 TATTCTCACAACTCTGAGGCTGG + Intronic
904707811 1:32404655-32404677 TTTTTTCCCAAAAGGGAGACTGG + Intergenic
905526348 1:38642879-38642901 GATTCTTACAAGAGGGAGGCAGG + Intergenic
907349094 1:53811342-53811364 TTCTCTCCCAGCTGGGAGGCGGG + Intronic
910682414 1:89881221-89881243 TATTCAGCCAACAGGAAGGCTGG + Intronic
910917664 1:92308312-92308334 TATTTTCCCAACAAGGAAGCTGG - Intronic
915439587 1:155936965-155936987 AATTTTCCCAAAAGGAAGGCTGG - Intergenic
916725217 1:167517253-167517275 TCTGCTCCCACCAGGGAGCCAGG - Intronic
918261309 1:182798854-182798876 AATTCTTTCAGCAGGGAGGCAGG - Intronic
922160642 1:223077356-223077378 TGATCTCCCAACAGGAAAGCTGG - Intergenic
923877754 1:238068191-238068213 AATTCTGCCACCAGGGAGTCAGG + Intergenic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1066416976 10:35230816-35230838 TTTCCTCCCAACCGGGAGACAGG + Intergenic
1067082779 10:43221077-43221099 TCTTCTCCCAGCAGGGCGTCTGG - Intronic
1070624114 10:78036954-78036976 CATTCTCTCAACAGGGAGTTTGG - Intronic
1073096855 10:100985121-100985143 GATTCCCCCAAAAGAGAGGCTGG - Exonic
1073311882 10:102548808-102548830 TTTCCTACAAACAGGGAGGCAGG + Intronic
1076581549 10:131515602-131515624 TCTTCTCACAACAGCCAGGCTGG + Intergenic
1080188800 11:29521781-29521803 TATTTTCCCAGCAGGGAAACTGG - Intergenic
1085041779 11:73331056-73331078 TCTTCTCCCTACCGTGAGGCAGG + Intronic
1085834917 11:79943310-79943332 TATTCTTTCTACAGGGAAGCAGG - Intergenic
1086522321 11:87683501-87683523 AAATCTCCCAACAGGGAAGCTGG + Intergenic
1087781728 11:102308583-102308605 GATTCTAGCAACAGGGGGGCAGG + Intergenic
1088734953 11:112720950-112720972 TATTCCCCTACCAGGGAGGCTGG + Intergenic
1091350349 11:134889061-134889083 TATTTCCCCAACAGGTAGGCAGG - Intergenic
1091856229 12:3742531-3742553 ATTTCTCCCAGCAGGGAGCCAGG - Intronic
1092051839 12:5476516-5476538 TATTCTCCCAGCAGACACGCAGG - Intronic
1094048169 12:26190322-26190344 TATCCTCACAACATGGTGGCTGG - Intronic
1094286947 12:28806199-28806221 TTTTCTCCAAACTGGGAGGAGGG - Intergenic
1096520372 12:52181453-52181475 TATTCCCTCCAAAGGGAGGCTGG + Intronic
1097761193 12:63466423-63466445 TATTCTCCCAAGACTGAGCCAGG - Intergenic
1100476654 12:94941353-94941375 TATTTTACCAAGAGGGAAGCTGG + Intronic
1102937069 12:116906548-116906570 TATCCTTCTAAGAGGGAGGCAGG + Intergenic
1103202343 12:119098104-119098126 TATCCTCACAACATGGCGGCTGG - Intronic
1106066489 13:26357216-26357238 TATTTTCCCACCAAGGATGCCGG - Intronic
1106168239 13:27267999-27268021 TTTTCCCCCATCAGGGAGGAAGG + Intergenic
1107427080 13:40304897-40304919 TATTCTTCCAAGAAGGAGCCTGG + Intergenic
1112269382 13:97954375-97954397 TATTCTCCCTATAGGAAAGCAGG - Intronic
1112958224 13:105088112-105088134 TATTCAGTCACCAGGGAGGCAGG + Intergenic
1118442658 14:65826388-65826410 CATGCACCCAACAGGGAGGAAGG - Intergenic
1118462773 14:66002048-66002070 CATGCTGCCAACGGGGAGGCTGG + Intronic
1118481444 14:66171206-66171228 GGTTCTCACAAGAGGGAGGCAGG - Intergenic
1118905793 14:70022238-70022260 TTTTCTCCCAAAACGGAGTCAGG - Intronic
1124048744 15:26175744-26175766 TATTCTCACAAGTGTGAGGCAGG - Intergenic
1127840584 15:62828088-62828110 TACTCTCCCAACTGGGAAACAGG + Intronic
1128521715 15:68379658-68379680 TGTTCTCCCCGCAGAGAGGCTGG + Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1130348300 15:83068119-83068141 TTTTCTCCCTTCAGTGAGGCAGG + Intergenic
1130644967 15:85716524-85716546 TATTCACCCGACGGGAAGGCAGG - Intronic
1131070116 15:89460807-89460829 TATTTTCCCAGCCAGGAGGCCGG + Intergenic
1136687043 16:32001749-32001771 TATACTCCCCACAGCGAGCCAGG - Intergenic
1136787652 16:32945300-32945322 TATACTCCCCACAGCGAGCCGGG - Intergenic
1136882126 16:33908489-33908511 TATACTCCCCACAGCGAGCCGGG + Intergenic
1140831633 16:78756946-78756968 TATCCTCCCAACATGGCAGCTGG - Intronic
1143567759 17:7734946-7734968 TATTTTCCCAGCTGGGTGGCAGG - Intronic
1144956727 17:19022374-19022396 TATTGTCCCAGCTGGGCGGCTGG - Intronic
1146916242 17:36680188-36680210 TATTTTCCCCAGAGGGAAGCGGG + Intergenic
1147148007 17:38497420-38497442 TATACTCCCCACAGCGAGCCGGG - Intronic
1147606235 17:41775339-41775361 TATTCCTGCAACAGGAAGGCTGG + Intronic
1151017539 17:70574190-70574212 CATTCTCCCAACCAGGAGGGAGG + Intergenic
1151150320 17:72079582-72079604 TCTTCTCCCAGCAGAGAGGATGG - Intergenic
1152410221 17:80119347-80119369 TAGTCTCTCCAGAGGGAGGCTGG + Intergenic
1154194769 18:12257555-12257577 TATTCTGCCCCGAGGGAGGCAGG - Intronic
1156193483 18:34746628-34746650 TAGTCTCCCCACAGGGACTCTGG + Intronic
1160359964 18:78266828-78266850 TTTTATCCCAACCTGGAGGCTGG - Intergenic
1163151302 19:15416409-15416431 TATCCTCACAACATGGTGGCTGG - Intronic
1163288047 19:16361528-16361550 TTTTCTTCCAGCAGGGAGGCGGG - Intronic
925028129 2:625501-625523 GGATCTCCCATCAGGGAGGCCGG - Intergenic
927875165 2:26650398-26650420 CATTCTGCCCACAGGGTGGCTGG + Intergenic
930593071 2:53353408-53353430 TACTTTCTCAGCAGGGAGGCTGG + Intergenic
931645997 2:64422559-64422581 TGTTCTCACAGCAGGGTGGCAGG - Intergenic
939835190 2:147121229-147121251 AAGTGTCCCAACAGGGAGTCAGG + Intergenic
946439876 2:219686085-219686107 TATCCATCCAACAGGAAGGCAGG - Intergenic
948254209 2:236554141-236554163 TATTTTCCCAGAAGGGAGGAAGG - Intergenic
948496896 2:238356521-238356543 TATCCTCCCAACTGGGAGGAGGG - Intronic
1169208899 20:3754819-3754841 TTTTCTCCCAAAAGGAAGGCAGG + Intronic
1170540977 20:17387753-17387775 TAGGATCCCAACTGGGAGGCGGG + Intronic
1172887532 20:38241247-38241269 GAGTCTCCCAGTAGGGAGGCAGG - Exonic
1173733553 20:45344543-45344565 ACTTCTCCCAACAGGGAGATGGG + Intronic
1174941221 20:54930737-54930759 TGTTGTCCACACAGGGAGGCTGG - Intergenic
1177065861 21:16435009-16435031 TCTTCTCCCAACTGGAAAGCTGG - Intergenic
1177852643 21:26366861-26366883 TATTCTTACAACATGGAGGCTGG + Intergenic
1179570165 21:42273879-42273901 CATTTTCCCACCTGGGAGGCAGG - Intronic
1180091294 21:45534990-45535012 GCTTCTCTGAACAGGGAGGCGGG + Intronic
1181028122 22:20137324-20137346 TGTTCGCCCATCAGGCAGGCGGG - Intronic
1181474402 22:23159468-23159490 TATTCCCCCATCCGTGAGGCAGG - Intronic
1184105191 22:42363358-42363380 TGTTCTCCCAACAGGCAGGGTGG + Intergenic
1184475549 22:44719327-44719349 TATAATCCCAACACTGAGGCAGG - Intronic
1185034465 22:48464607-48464629 TCTTCTCCAAACAGGGGAGCAGG - Intergenic
950532618 3:13561295-13561317 TGTTGTCCCAACAGGGTGGCAGG - Intronic
950681433 3:14587851-14587873 TATACTCCCAACAGGTAGGCAGG + Intergenic
951197411 3:19839895-19839917 TATCCTCCCAACACTGAGCCAGG + Intergenic
954446142 3:50547842-50547864 TATTTTTCCACCAGGGAGGATGG - Intergenic
957172660 3:76758644-76758666 CATTTTCCCAACAGAGAGGTGGG - Intronic
957185748 3:76939051-76939073 TATTCAGCCAACAGAGAGGTGGG + Intronic
957631737 3:82724717-82724739 TATCCTTCTAAGAGGGAGGCAGG + Intergenic
960041111 3:113150578-113150600 TGTCCTCCCAACACAGAGGCAGG + Intergenic
962919156 3:139935505-139935527 TCTTCTCCCAGGAGGGAGGCAGG + Intronic
964120130 3:153174595-153174617 AATTGTCCCAACAGGTAGGGTGG - Intergenic
964361994 3:155908237-155908259 TGTTCTCCCAGTAGGCAGGCTGG - Intronic
968624681 4:1621795-1621817 TATTCCCCCAACACGGTGCCAGG - Intronic
969332296 4:6482264-6482286 TATTCACCTCACAGGGAAGCTGG - Intronic
972939110 4:44175766-44175788 TATGCTTCCAAAGGGGAGGCTGG + Intronic
974849472 4:67387444-67387466 TTTTCTCCCAACAAGTAGGCAGG + Intergenic
976556138 4:86453319-86453341 TATTTTCACAGCTGGGAGGCGGG + Intronic
978710624 4:111776096-111776118 TATCTTCCCAACTGGGAGGGGGG + Intergenic
984949130 4:184993799-184993821 TTTTCTCCCCACAGAGAGACTGG + Intergenic
989209683 5:38846376-38846398 TTTTCACCCACCAGGTAGGCAGG - Exonic
992231892 5:74671920-74671942 TATTCTCCTCACATGGAGACCGG + Intronic
993783456 5:92098315-92098337 TATTCTCCCAACACTGGGGCTGG + Intergenic
996007785 5:118443816-118443838 TATTATCCCAGCAGCGTGGCAGG - Intergenic
999596359 5:153209761-153209783 GATTCTCCCAGCAAGGGGGCTGG - Intergenic
1001199384 5:169702137-169702159 TTTTCCCTCATCAGGGAGGCTGG - Intronic
1001676913 5:173526287-173526309 TGTTCTCACAACATGGTGGCTGG - Intergenic
1008775448 6:55032243-55032265 TATTTTCACAGCTGGGAGGCAGG - Intergenic
1009059787 6:58385201-58385223 TATTCTCATAAGAGGGAGGTGGG - Intergenic
1010624219 6:78116453-78116475 TCTTATCCCATCATGGAGGCAGG - Intergenic
1011125453 6:84002633-84002655 TATGATGCCAACAGAGAGGCTGG + Intergenic
1013080992 6:106812867-106812889 CACCCTCCCAACAGTGAGGCAGG + Intergenic
1014654099 6:124077716-124077738 TATGGTCCCACAAGGGAGGCAGG - Intronic
1015030009 6:128583889-128583911 AATTTTCCCATCTGGGAGGCAGG + Intergenic
1019214356 6:170433753-170433775 GGTTCTCATAACAGGGAGGCAGG + Intergenic
1019807439 7:3138326-3138348 TGTTCTCACAACATGGCGGCCGG - Intergenic
1021080816 7:16362245-16362267 TATTCTCACAGCGTGGAGGCTGG + Intronic
1022791276 7:33691702-33691724 TATAATCCTAAGAGGGAGGCAGG + Intergenic
1026913468 7:74106194-74106216 TATACTCCCAGCGGGGAGGCGGG + Exonic
1027404508 7:77846016-77846038 TATTCTCACAACATGGAGAAAGG - Intronic
1033473251 7:141667609-141667631 TCATCACCCATCAGGGAGGCAGG + Intronic
1034822966 7:154234144-154234166 TAGCCTCTCAACAGGAAGGCAGG + Intronic
1034927795 7:155136890-155136912 TGTCCTCCCAACATGGTGGCTGG - Intergenic
1035469812 7:159102640-159102662 CATTCTCCCAAGAGGCAGCCAGG + Intronic
1036602242 8:10272064-10272086 TATTCTCCAACCATGGATGCTGG + Intronic
1036791713 8:11725517-11725539 TCTTCTCCCAACAGGAAACCAGG - Intronic
1037930118 8:22874366-22874388 CATTCTCCCTGCATGGAGGCAGG - Intronic
1037945235 8:22985632-22985654 CCTTTTCCCAACAGGGAGGAAGG + Intronic
1039376942 8:37044287-37044309 TCCTCTCCCCAAAGGGAGGCTGG - Intergenic
1042307154 8:67343758-67343780 TTTCCTCCCAACATGGCGGCCGG - Intergenic
1044237857 8:89852572-89852594 CATTCTTAAAACAGGGAGGCAGG - Intergenic
1048137136 8:131757456-131757478 AATTCTCCCAACGCTGAGGCTGG + Intergenic
1049718913 8:144106697-144106719 TATCGGCCCAACAGGGAGGTGGG - Intronic
1049781829 8:144432616-144432638 GATTCTCCCAGCTGGGAGGGCGG + Intronic
1050175228 9:2863433-2863455 ATTTCTAACAACAGGGAGGCAGG + Intergenic
1057843138 9:98502293-98502315 CACTGTCCCATCAGGGAGGCTGG + Intronic
1057936702 9:99245843-99245865 GATTCTCACAAAAGGGAGGCTGG - Intergenic
1058299446 9:103352580-103352602 TGTTCTTCTAAGAGGGAGGCAGG - Intergenic
1060998392 9:127887732-127887754 CATGCTCCCATCAGCGAGGCTGG - Intronic
1061372698 9:130206766-130206788 CATTTTCCCAAGAGAGAGGCAGG - Intronic
1061801380 9:133115087-133115109 TATTCTACCCAGAGGGAGTCTGG - Intronic
1062054058 9:134461781-134461803 CATCCTCTCAACATGGAGGCTGG + Intergenic
1190080657 X:47354600-47354622 CCTTCTCCCAACAGGAAGCCTGG - Intergenic
1190260128 X:48792208-48792230 ATTTCTCACCACAGGGAGGCAGG - Exonic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1193549560 X:82873480-82873502 TATTCACCCAATATTGAGGCAGG + Intergenic
1195098790 X:101532932-101532954 TATTCTCCCAACAGGGAGGCAGG - Intronic
1195669685 X:107459196-107459218 ACATCCCCCAACAGGGAGGCCGG + Intergenic
1196966743 X:121064739-121064761 TACTTTCACATCAGGGAGGCTGG - Intergenic
1197714670 X:129697817-129697839 TATTTTACCAACGGGAAGGCAGG - Intergenic
1201449828 Y:14099807-14099829 TTTTCTCCCAACTGGGAACCAGG - Intergenic