ID: 1195100547

View in Genome Browser
Species Human (GRCh38)
Location X:101551018-101551040
Sequence CCTGCAGGTCAGTGTAAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195100541_1195100547 12 Left 1195100541 X:101550983-101551005 CCATTTGGGAACAAAGGAATAGT 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1195100547 X:101551018-101551040 CCTGCAGGTCAGTGTAAAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195100547 Original CRISPR CCTGCAGGTCAGTGTAAAGC TGG Exonic
900471264 1:2856165-2856187 CCTGCAGGTCAGGGGAGAGCTGG + Intergenic
900817124 1:4856892-4856914 CCTGCATGGCTGTGTGAAGCAGG + Intergenic
901396640 1:8986788-8986810 CCTGCAGGTCAGGGTTGGGCGGG + Intergenic
901639671 1:10686902-10686924 CCTGCCGGGCAGTGGAGAGCCGG + Intronic
902522246 1:17026274-17026296 CCTGCAAGTCAGAGTAAGCCTGG - Intronic
903225427 1:21892097-21892119 CCTGATGGACAGAGTAAAGCGGG - Intronic
908680292 1:66653079-66653101 CCTGCAGGTCTGTCTAGAGGGGG - Intronic
911870862 1:103096568-103096590 TCTGAAGTTCAGGGTAAAGCAGG + Intronic
917496086 1:175541258-175541280 CCTGCAGGCCAAGCTAAAGCTGG - Intronic
919672667 1:200351932-200351954 CCTGGAGGTTACTGTGAAGCAGG - Intergenic
921263887 1:213406484-213406506 CCTGGAGGTCAGAGGAAAGGTGG + Intergenic
923551063 1:234963751-234963773 CCTTCAGGTCAGTGAATAGATGG - Intergenic
1063023434 10:2153785-2153807 TCTGCAGGACAGTGTAAGGACGG + Intergenic
1070485019 10:76922025-76922047 GCTGGAGGTCAGTGTCAAGGAGG + Intronic
1070500413 10:77067278-77067300 CCTGATGGTCAGTCTTAAGCTGG + Intronic
1072607156 10:96994323-96994345 CATGTAGGTCAGTATAAAGAGGG + Intergenic
1074533116 10:114310520-114310542 CCTGCAGGTCAGGGGAGAGTGGG + Intronic
1077453222 11:2663227-2663249 CCAGCAGATCACTGGAAAGCAGG + Intronic
1083900526 11:65641179-65641201 CCAGCGGGTCAGTGAAGAGCCGG - Exonic
1085032012 11:73277604-73277626 CCTGCAGGACAATGCAAAGGGGG + Intronic
1088757649 11:112899503-112899525 CAGGCAAGTCAGTGTGAAGCCGG + Intergenic
1091975332 12:4820033-4820055 CCTGCACGTCAGAGAAAGGCAGG + Intronic
1092262532 12:6960233-6960255 CCTGCAGGTGCGTGCAGAGCAGG + Exonic
1093382855 12:18516301-18516323 CCTGCAGGGCAGGAGAAAGCAGG - Intronic
1096155988 12:49341922-49341944 CCTGCTCGTCAGAGAAAAGCTGG - Intergenic
1099125008 12:78743535-78743557 CCTGGAGGACATTATAAAGCAGG - Intergenic
1103716038 12:122945920-122945942 CCTGCATGTTGGTGTCAAGCTGG - Intronic
1105738460 13:23297052-23297074 CCGGCTTGTCTGTGTAAAGCTGG - Intronic
1107939974 13:45374778-45374800 GCTGCAGGCCAGTGAAGAGCTGG + Intergenic
1112806158 13:103165825-103165847 CCTGCAGGGTAATGTTAAGCTGG + Intergenic
1112896265 13:104304094-104304116 CTTGAAAGTCAGTGTAAAACAGG + Intergenic
1113862825 13:113501007-113501029 CCTGAAGGTCAGTGAGGAGCAGG - Intronic
1118439103 14:65797098-65797120 CCTGCAGTCCAGTGCTAAGCAGG - Intergenic
1126949596 15:53866598-53866620 CCTGCGGGTCAGGGGCAAGCTGG - Intergenic
1130081048 15:80733690-80733712 TTTGCAAGTCAGTGTCAAGCAGG + Intronic
1130792247 15:87167943-87167965 CCTGCAGCTGAGAGTCAAGCAGG - Intergenic
1130991629 15:88879189-88879211 CCAGCAGGTCTGTGCAGAGCAGG - Exonic
1134881195 16:17746660-17746682 CCTACAGGCCAGGGTAAAACAGG - Intergenic
1135111048 16:19691146-19691168 CCTGCAGGACAGTCTAAGCCAGG - Intronic
1137290888 16:47051194-47051216 CCTGCAGGTAGGTGCACAGCTGG + Intergenic
1139952307 16:70678368-70678390 CCTGCAGGGCACTGTCCAGCTGG + Exonic
1140199423 16:72882336-72882358 CCAGAAGGGCAGTGTACAGCTGG + Intronic
1142401526 16:89861099-89861121 CCTGGAGGTCAGTGTGAGGGGGG + Intronic
1143762391 17:9114853-9114875 TCTGCAGGTCAGTAGAAACCAGG - Intronic
1144956040 17:19019401-19019423 CCTGCAGGCGAGTGGAAGGCAGG - Exonic
1147266934 17:39240108-39240130 CCTGCAGGTGAGCCTGAAGCTGG + Intergenic
1147367040 17:39965895-39965917 CCTTCAGGTCAGCCTCAAGCGGG + Exonic
1147623477 17:41883910-41883932 CCTGGTGGGCAGTGGAAAGCTGG - Intronic
1150103890 17:62447694-62447716 TCTGCAGGTCAGTGTCTATCTGG + Exonic
1151690791 17:75683961-75683983 CTAGCAGGTCAGAGTGAAGCAGG - Intronic
1151766277 17:76135060-76135082 CCTCCAGGTGACTGTCAAGCTGG + Intergenic
1152431611 17:80251346-80251368 CCTTCAGGTCAGCGGACAGCAGG - Exonic
1157586127 18:48802412-48802434 CCTGGAGGGAAGTGTAAGGCAGG + Intronic
1161762169 19:6182042-6182064 CCTGCAGTTCTGGGTAAACCAGG + Intronic
1166083818 19:40461942-40461964 GCTGCAGGTCAGCATAAAGAGGG - Intronic
1166256176 19:41606444-41606466 CCTGAAGGGCAGTGTGAAGAAGG + Intronic
1167851531 19:52206057-52206079 CCTGCTGGTGAGTGGAAGGCAGG + Exonic
925043725 2:754802-754824 CCTGCATGCCAGGCTAAAGCAGG + Intergenic
928108210 2:28486477-28486499 TCTGCAGGGCAGTGGGAAGCTGG + Intronic
929992014 2:46798249-46798271 CCTGTGAGTCAGTGTAGAGCAGG - Intergenic
930693625 2:54389410-54389432 ACTGCAAGTCAGTGTAGACCTGG + Intergenic
937164077 2:119795394-119795416 CCTGCAGGCCAGTGCTAAGCGGG + Intronic
937451855 2:122008721-122008743 CCTGCAGGGCTGTGCAAAGGGGG + Intergenic
939011884 2:136856123-136856145 CCTGTATGTCAGTGAAGAGCAGG + Intronic
939583476 2:143979049-143979071 CCTGGTTGTCAGAGTAAAGCAGG - Intronic
942178356 2:173355688-173355710 CCTGCAGCTAAGAGTAAGGCTGG - Intronic
945155308 2:206831732-206831754 CCTGCTGCTCCCTGTAAAGCAGG + Intergenic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
947461315 2:230306774-230306796 CCTGCAGGCCAGTGCTGAGCTGG - Intronic
948207599 2:236170478-236170500 CCGGCATGTCAGTGGCAAGCCGG - Intergenic
948489260 2:238301446-238301468 CCTTCATGTCAGTGTATATCTGG + Intergenic
1171400075 20:24867476-24867498 CCTGCAGGGCATTGCAGAGCTGG - Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174043505 20:47716693-47716715 CCTGCATGTCTGTGTGAGGCTGG - Intronic
1174586627 20:51613661-51613683 CATGCAGGTGAGTGGACAGCTGG - Exonic
1175291463 20:57878821-57878843 CTTGCAGGTCAGAGTAATCCGGG - Intergenic
1175771079 20:61624742-61624764 CCTGCAGCTCTTTGTAAACCTGG - Intronic
1178743085 21:35221793-35221815 CCTGTAGGTCACTGCAAAGAAGG - Intronic
1178785661 21:35650887-35650909 CCTGCAGGTGATTTTAAAGCAGG - Intronic
1183689049 22:39377786-39377808 CATGCAGGGCAGTGGAAGGCTGG + Intronic
1183992633 22:41608577-41608599 CCTGCAGGGCAGAGTGAAGGGGG + Intronic
1184041004 22:41943609-41943631 CCTCCAGGTCACAGTAGAGCAGG + Exonic
1184694911 22:46133754-46133776 CCTGTGGTGCAGTGTAAAGCTGG + Intergenic
949132290 3:518245-518267 ACTGTAGGTCAGTGTAACACAGG - Intergenic
950954241 3:17034297-17034319 CCAGCAGGTCAGGGTAAAAGGGG - Intronic
953781622 3:45876498-45876520 CCTGCAAGCAAGTGTAGAGCTGG + Intronic
965604787 3:170487123-170487145 GCAGGAGGTCAGAGTAAAGCTGG + Intronic
967019669 3:185511763-185511785 CCTGCAAGTCACTGGTAAGCTGG + Intronic
968867608 4:3223723-3223745 CCTCCTGGTCAGTGAGAAGCTGG + Intronic
969233037 4:5845197-5845219 CCTGCAGGGCCTTGAAAAGCAGG - Intronic
969349018 4:6587362-6587384 CCTGCAGCTCTGTGAGAAGCTGG - Intronic
976696941 4:87926965-87926987 CCTGCAGCTCTGTGAAAAGAAGG - Intergenic
980188945 4:129498009-129498031 CCTGCAGGCTAGTGTTAAGCAGG - Intergenic
981205745 4:142037785-142037807 CCTGCAGATCTGTGTAAAAATGG + Intronic
984291591 4:177802209-177802231 CATGAAAGGCAGTGTAAAGCAGG - Intronic
985859735 5:2461450-2461472 CCTGCAGCTCATTGCAAAGGTGG + Intergenic
989741065 5:44772674-44772696 ATTGCAGTTCAGTGTAAGGCTGG + Intergenic
991084820 5:62639180-62639202 CCTGCAAGTAAGTGTAAAAGTGG + Intergenic
991921109 5:71657855-71657877 CCTGCAGCTCAGGGGAGAGCTGG - Exonic
992005664 5:72475141-72475163 CCTGCATGTCAGAGCAAAGATGG - Intronic
997614809 5:135239137-135239159 CCTGCAGGTCAGTCTCAGGCAGG - Intronic
1000853124 5:166364429-166364451 TCTGCAGGTGAATGTGAAGCAGG + Intergenic
1005034198 6:21540695-21540717 ACTGTAAGTCAGTGGAAAGCTGG + Intergenic
1006376418 6:33674014-33674036 CCTGCAGGGCAGTACAAAGGGGG - Intronic
1013160424 6:107538573-107538595 CCTGCAGGCCAGGGTGCAGCTGG - Intronic
1014527633 6:122519928-122519950 CCAACAGTTCAGTGAAAAGCTGG - Intronic
1017531046 6:155292377-155292399 CCTGCAGATCAGTGCTCAGCAGG - Intronic
1017531788 6:155300065-155300087 CATTCAGGTCTCTGTAAAGCTGG + Intronic
1019210023 6:170397485-170397507 CCTGCAGCTCTGTGTGAATCTGG + Intronic
1021556325 7:21922420-21922442 CCTGCAGGGCAGTGATCAGCTGG - Intronic
1025760717 7:64388417-64388439 GCTGCAGGTCAGGAAAAAGCAGG + Intergenic
1027564208 7:79769514-79769536 CCTGCAGCTCATTGTGAAGTTGG + Intergenic
1028069265 7:86430883-86430905 CATACAAATCAGTGTAAAGCTGG + Intergenic
1028077021 7:86529232-86529254 CCTGCAGTATAGTGTAAAGCTGG + Intergenic
1029715671 7:102324111-102324133 CCAGGAGGTCAGTGAAAAGGGGG + Intergenic
1032033072 7:128500896-128500918 TCTGCAGGTCAGTGTCTATCTGG + Exonic
1034441904 7:151089957-151089979 ACTGCAGGTGAGTGCCAAGCCGG - Intronic
1034917266 7:155051037-155051059 CTTGCAGGACAGTGAAAAGATGG + Intergenic
1036418043 8:8568804-8568826 CCTGCAGATCACTGCAAACCTGG + Intergenic
1037948872 8:23006092-23006114 CCTCCAGGTCAGCGTAGCGCAGG - Exonic
1041277205 8:56174635-56174657 CCTGTAGGTCATTGTGATGCTGG - Intronic
1047205393 8:122799108-122799130 CCTTCATGTAAGTGTAAAGGAGG - Intronic
1047495383 8:125405180-125405202 CCTGCAGGTCAGTTCACAGGAGG + Intergenic
1053382026 9:37656720-37656742 CCTGAAGGACAGTGGGAAGCCGG + Intronic
1057909257 9:99005225-99005247 CCTGGAGGTCAGTGAGCAGCTGG + Intronic
1060277404 9:122192532-122192554 CCTGCAGGTCAGTGCACAGCTGG - Intronic
1060851479 9:126880395-126880417 CCTGCAGGTCACTGTGCAGGTGG - Exonic
1061568144 9:131457969-131457991 ACTGCAGATCAGAGAAAAGCGGG - Intronic
1185596260 X:1308717-1308739 CCTGGGGGTCAGTGGAAAGCGGG - Intronic
1187401974 X:18968405-18968427 CCTGCATATCTGTGTGAAGCTGG - Intronic
1195100547 X:101551018-101551040 CCTGCAGGTCAGTGTAAAGCTGG + Exonic
1195107833 X:101617487-101617509 CTTGCAGGTCAGTGTGAAGGTGG - Exonic
1195308420 X:103608052-103608074 CCGGCAGGTCAGTGTGAAGGTGG + Intronic
1198888388 X:141364357-141364379 TCTGCAGGACAATATAAAGCAGG + Intergenic