ID: 1195105727

View in Genome Browser
Species Human (GRCh38)
Location X:101600108-101600130
Sequence AACCCTTAGGAACCGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195105727_1195105737 29 Left 1195105727 X:101600108-101600130 CCCTGTCCCGGTTCCTAAGGGTT No data
Right 1195105737 X:101600160-101600182 CTCCCAAGCCAGCCGCAGTTTGG No data
1195105727_1195105732 -4 Left 1195105727 X:101600108-101600130 CCCTGTCCCGGTTCCTAAGGGTT No data
Right 1195105732 X:101600127-101600149 GGTTCCTAAGAGCTGTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195105727 Original CRISPR AACCCTTAGGAACCGGGACA GGG (reversed) Intergenic
No off target data available for this crispr