ID: 1195107156

View in Genome Browser
Species Human (GRCh38)
Location X:101613659-101613681
Sequence AACCCTTAGGAACCGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195107146_1195107156 29 Left 1195107146 X:101613607-101613629 CCAAACTGCGGCTGGCTTGGGAG No data
Right 1195107156 X:101613659-101613681 AACCCTTAGGAACCGGGACAGGG No data
1195107151_1195107156 -4 Left 1195107151 X:101613640-101613662 CCTTCTGACAGCTCTTAGGAACC No data
Right 1195107156 X:101613659-101613681 AACCCTTAGGAACCGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195107156 Original CRISPR AACCCTTAGGAACCGGGACA GGG Intergenic
No off target data available for this crispr