ID: 1195107690

View in Genome Browser
Species Human (GRCh38)
Location X:101616661-101616683
Sequence CTCTTCAATCAGGTGGAGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195107690_1195107701 11 Left 1195107690 X:101616661-101616683 CCTTGCTCCACCTGATTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1195107701 X:101616695-101616717 CCAGGGTGAGTAAGGATGGAGGG 0: 1
1: 0
2: 2
3: 22
4: 259
1195107690_1195107696 -6 Left 1195107690 X:101616661-101616683 CCTTGCTCCACCTGATTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1195107696 X:101616678-101616700 GAAGAGGTCTCTCAGGTCCAGGG 0: 1
1: 0
2: 1
3: 18
4: 271
1195107690_1195107698 7 Left 1195107690 X:101616661-101616683 CCTTGCTCCACCTGATTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1195107698 X:101616691-101616713 AGGTCCAGGGTGAGTAAGGATGG 0: 1
1: 0
2: 1
3: 22
4: 238
1195107690_1195107695 -7 Left 1195107690 X:101616661-101616683 CCTTGCTCCACCTGATTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1195107695 X:101616677-101616699 TGAAGAGGTCTCTCAGGTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 185
1195107690_1195107697 3 Left 1195107690 X:101616661-101616683 CCTTGCTCCACCTGATTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1195107697 X:101616687-101616709 TCTCAGGTCCAGGGTGAGTAAGG 0: 1
1: 0
2: 2
3: 27
4: 671
1195107690_1195107699 10 Left 1195107690 X:101616661-101616683 CCTTGCTCCACCTGATTGAAGAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1195107699 X:101616694-101616716 TCCAGGGTGAGTAAGGATGGAGG 0: 1
1: 0
2: 2
3: 33
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195107690 Original CRISPR CTCTTCAATCAGGTGGAGCA AGG (reversed) Exonic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900818357 1:4867796-4867818 CTCTTCAATCATATGGAAAAAGG - Intergenic
902288367 1:15421252-15421274 ATCTTCAATCAGGTTGACCCTGG + Intronic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
908991317 1:70094022-70094044 TTCTTCCCTCAGATGGAGCAAGG - Intronic
915197331 1:154199493-154199515 CTTTTCAAACAGCTGGTGCAGGG + Exonic
918048643 1:180955981-180956003 CTGTTCATGCAGGTGCAGCAGGG - Intergenic
918665788 1:187149048-187149070 CTCTTCAATCAAATGGTGCTTGG - Intergenic
920003547 1:202815818-202815840 CTCTTCTGGCAGGTGGAGAAGGG - Intergenic
920563835 1:206958410-206958432 CTCTTCCCACAGGTGGAGGAAGG + Exonic
921218370 1:212955734-212955756 GTCTTCACTCAGGTGAAGCTCGG - Intronic
921654647 1:217720280-217720302 TTCTGCAATGAGGTGGAGTATGG + Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1064451121 10:15442828-15442850 TTTTTAAAACAGGTGGAGCATGG - Intergenic
1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG + Intergenic
1065967298 10:30780555-30780577 CTTTTCTAGCAGGTGGGGCATGG + Intergenic
1069334144 10:67328312-67328334 CTCTGCAAGCAGGTGTAGCCAGG + Intronic
1070147641 10:73786181-73786203 CTCTTCAACCAGGGGAAGAAAGG + Intronic
1074902220 10:117828134-117828156 CTCTTCCATCAGCAGGATCAGGG + Intergenic
1075680284 10:124326336-124326358 CTCTCCATACAGGTGGAGCTAGG - Intergenic
1076421063 10:130331878-130331900 CTCTGCAAGATGGTGGAGCAGGG - Intergenic
1078740104 11:14058567-14058589 ACCTGCAAGCAGGTGGAGCAAGG + Intronic
1088878134 11:113952587-113952609 CTCTTCAAAGAGGATGAGCAGGG - Intergenic
1089685016 11:120141235-120141257 CTCTCCAACCAGGATGAGCATGG + Intronic
1091816344 12:3441582-3441604 CTCTGCAGGCATGTGGAGCACGG - Intronic
1092110455 12:5958719-5958741 CTCTTCACTTAGGGGAAGCAGGG + Intronic
1093929158 12:24937673-24937695 CTCCTCAACCCGGTGGGGCATGG - Intronic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1100750131 12:97689585-97689607 CACTTCAATGAAGAGGAGCAAGG - Intergenic
1105589910 13:21782620-21782642 ATTTGCATTCAGGTGGAGCATGG + Intergenic
1110390726 13:74970675-74970697 ATCTTCACTCAGCAGGAGCAGGG + Intergenic
1111654802 13:91139218-91139240 CTATCCATTCAGATGGAGCAGGG + Intergenic
1118236741 14:64012031-64012053 CCATTCAATCGGGTGGAGGAGGG + Intronic
1119646313 14:76351004-76351026 CTATTCAGTCAGGTAGAGGATGG + Intronic
1121549466 14:94787814-94787836 CTCTTCAAAGAGGTGTAGGAAGG - Intergenic
1121886685 14:97549536-97549558 CTCTTCAATGTGGAGGATCAAGG - Intergenic
1128177692 15:65570763-65570785 CCTTTCAGTCAGCTGGAGCAAGG + Intronic
1129267808 15:74403399-74403421 CTCCTCAATGAGGTCCAGCAAGG - Intergenic
1130416674 15:83701073-83701095 CTCTGCAAACAGGAGAAGCAGGG - Intronic
1136600433 16:31283490-31283512 CAATTCAATCAAGTGGAGAAAGG - Intronic
1141544656 16:84756972-84756994 CTCTTGAGTCAGGTGGACCCAGG + Intronic
1142524183 17:526959-526981 TTCTTCAATGAGGTGGCACAGGG + Intronic
1143679357 17:8464918-8464940 CTCCTCAAGCAGGTTGAGGATGG - Intronic
1143764940 17:9131342-9131364 CTCTTCAATCACGAGAAACAGGG + Intronic
1149979884 17:61301979-61302001 CTCTAGAATTAGGTGAAGCACGG + Intronic
1151110457 17:71670272-71670294 GTCTTCAGTCAAGTGGACCAGGG - Intergenic
1152428921 17:80236629-80236651 CTCTGAAATCAGGTGGCCCAGGG - Intronic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1155732231 18:29175049-29175071 CTCTCCAATCACATTGAGCAGGG + Intergenic
1156503033 18:37571612-37571634 CTCTTCTATCAAGTGGAGACTGG + Intergenic
1157605961 18:48926140-48926162 CTCTGCCTTCAGGTGGAGAATGG - Intronic
1162048657 19:8018606-8018628 ATCTTCAACCAGGTTGGGCACGG - Intronic
1162993737 19:14320239-14320261 CTCTGCCTTCAGGTGGGGCAAGG - Intergenic
1163525043 19:17815721-17815743 CTACTCAATCCAGTGGAGCAGGG - Intergenic
1164002850 19:21120683-21120705 CCCTTCAGTAAGGTGGAACAGGG - Exonic
926830867 2:16960285-16960307 TTCTTGAATCTGGTGGAGAAAGG + Intergenic
930707642 2:54520455-54520477 TTCTTCAAACAGGTGGATCAAGG - Intronic
931016130 2:57982641-57982663 CCCTGCAAGCAGGTGCAGCAAGG + Intronic
932798244 2:74716110-74716132 CTCTTCTCTTAGGTGAAGCATGG + Intergenic
934762350 2:96863736-96863758 CTCCTCAATCAGGTGAACCCAGG + Exonic
940871848 2:158867201-158867223 CTCTTCAGCCAGGTTGAGCAGGG - Intergenic
943938804 2:193963099-193963121 ATCTTGAAACAGGTGCAGCAAGG - Intergenic
943993045 2:194721710-194721732 CACTTGTAACAGGTGGAGCAGGG + Intergenic
947594642 2:231403325-231403347 CTCTTCTGCCAGGTTGAGCAGGG - Intergenic
1169264333 20:4158427-4158449 ATCTGGATTCAGGTGGAGCATGG + Intronic
1170657842 20:18306321-18306343 CTCATCACCCAGCTGGAGCAAGG + Exonic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1175526030 20:59634251-59634273 CTCTGAAATCAGGCGGAGCTGGG + Intronic
1176342826 21:5714200-5714222 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1176475080 21:7146351-7146373 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1176502001 21:7610256-7610278 CTTTTAAAACAGGTGGAGCCAGG + Intergenic
1176537147 21:8112269-8112291 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1179639745 21:42739321-42739343 CTCTGGATTGAGGTGGAGCAGGG + Intronic
967952927 3:194854654-194854676 CTCTTCAAGCTGGCCGAGCAGGG - Intergenic
968358259 3:198124813-198124835 CTCTGGAATCAGTTGGAGGAAGG - Intergenic
969733866 4:8974039-8974061 CCCTTCTACCAGGTTGAGCAGGG - Intergenic
975383839 4:73732277-73732299 CTCTTCAACCAAGAGGAGAAGGG - Intergenic
984886535 4:184454939-184454961 CACTGCAGTTAGGTGGAGCACGG - Intronic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
986289599 5:6389090-6389112 GTCTTCAGTGAGATGGAGCAGGG + Intergenic
991460601 5:66854585-66854607 CACTTCCATCAGACGGAGCATGG + Intronic
993429451 5:87814005-87814027 CTCTGCAAGCAGGTGCAGCCAGG - Intergenic
994521507 5:100843695-100843717 ATCTTCATTCAGATGGATCATGG - Intronic
997028446 5:130094152-130094174 TTCTTCTATTAGGTGGAGGAGGG + Intronic
999134073 5:149306203-149306225 CTCTTCCCTGAGGTGGAGCAGGG + Intronic
1003537088 6:6984857-6984879 CTCTGCAGTGGGGTGGAGCATGG + Intergenic
1003995188 6:11533335-11533357 CTCTTAAATCTGATGGAGAAGGG + Intergenic
1004091284 6:12504507-12504529 CTCCTGAATCAGGTTGACCAGGG - Intergenic
1004719015 6:18249017-18249039 CTCTTCAGTCAGGTAGATCATGG - Intronic
1005177705 6:23065866-23065888 CTCTGCAGTCAGGTGCAGGATGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007824783 6:44592321-44592343 CCCCTCATTCAGCTGGAGCATGG + Intergenic
1012585134 6:100912885-100912907 CAATTCAATCAAGTGGAGAAAGG - Intergenic
1016302411 6:142646899-142646921 CCCTTCAATCTGGTGGAGATTGG - Intergenic
1016989027 6:149916730-149916752 CTTTTCAATTAGGTGTACCAAGG + Intergenic
1016993967 6:149947934-149947956 CTTTTCAATTAGGTGTACCAAGG - Intronic
1017004366 6:150019603-150019625 CTTTTCAATTAGGTGTACCAAGG + Intronic
1018530324 6:164756218-164756240 CTCATCACTCAGCTGGTGCAGGG - Intergenic
1030188407 7:106786641-106786663 CTCTCCAATCAAATGGAGCTAGG - Intergenic
1031726162 7:125242179-125242201 CTTTTAAATCAGTTGGAGGAGGG + Intergenic
1038828293 8:31032057-31032079 GTCTTCAATCAGCTGAACCAAGG + Exonic
1039417794 8:37410346-37410368 CTCTTCAAGCTGCTGGAGAATGG - Intergenic
1041201391 8:55454040-55454062 CTCTTCCATCAGCTGCTGCAGGG - Intronic
1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG + Intergenic
1049471971 8:142779504-142779526 CACTTCAATCAGGCTGAGCACGG + Intergenic
1050745835 9:8874953-8874975 AGATTCACTCAGGTGGAGCAAGG + Intronic
1053339616 9:37312829-37312851 CTCTTCAAATAAGTTGAGCAGGG - Intronic
1057350465 9:94292997-94293019 CTCATCGAACAGCTGGAGCAAGG + Exonic
1058323440 9:103663425-103663447 CACCTCAGTCAGGTGGAGCCAGG + Intergenic
1059384448 9:113953298-113953320 TTCTTCAATCAGGAGTAGCATGG + Intronic
1060883887 9:127137163-127137185 CTCTACAATCAGGTGGCAGATGG - Intronic
1062742131 9:138181346-138181368 CTCTGGAATCAGTTGGAGGAAGG - Intergenic
1203458415 Un_GL000220v1:11750-11772 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1188407703 X:29832243-29832265 CTTTTAAGTCAGGTAGAGCACGG - Intronic
1195107690 X:101616661-101616683 CTCTTCAATCAGGTGGAGCAAGG - Exonic
1195173881 X:102296295-102296317 TTCTTCCGTCAGATGGAGCATGG + Intergenic
1195184984 X:102390798-102390820 TTCTTCCGTCAGATGGAGCATGG - Intronic
1195562631 X:106300876-106300898 CTAGTCAAACAGGTAGAGCATGG + Intergenic
1195578964 X:106480335-106480357 CACTTCACTCAGATGGACCATGG + Intergenic
1197956223 X:131951343-131951365 CTCTTGCCTCAGGCGGAGCAGGG - Intergenic