ID: 1195107838

View in Genome Browser
Species Human (GRCh38)
Location X:101617513-101617535
Sequence AAGGAGAAAACTGCCTTGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195107838_1195107841 9 Left 1195107838 X:101617513-101617535 CCAACCAAGGCAGTTTTCTCCTT 0: 1
1: 0
2: 1
3: 28
4: 210
Right 1195107841 X:101617545-101617567 AAACTTGTGCCGAAACCTACAGG 0: 1
1: 0
2: 0
3: 7
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195107838 Original CRISPR AAGGAGAAAACTGCCTTGGT TGG (reversed) Exonic
900960073 1:5913382-5913404 GTGGAGAAACCTGCCGTGGTGGG - Intronic
901184191 1:7361747-7361769 GGGGTGAAAACTGCCTTGGTGGG + Intronic
902699114 1:18159529-18159551 AAGGAGAAAACTCTTTTGCTTGG + Intronic
903981685 1:27193261-27193283 ATGGAGAAAACTGGCTTAATTGG - Intergenic
905005323 1:34705076-34705098 AAGCAGAAAACTGTCATGTTTGG + Intergenic
909942926 1:81631961-81631983 CAGGAGAAAAATGCCATGATAGG - Intronic
911544432 1:99199795-99199817 AAGAAGCAAACTGTCCTGGTTGG - Intergenic
912102120 1:106222623-106222645 AATGAGAAAACTGCATTCCTTGG - Intergenic
913076288 1:115343207-115343229 AAGGAGATCATTGACTTGGTTGG - Intergenic
915573473 1:156759276-156759298 AAGGAGAAAACTGGGTTGGAAGG - Intronic
916578572 1:166088377-166088399 TGGGAGAAAACTCCCTTGGGAGG - Intronic
918416742 1:184317104-184317126 AATTAGAAAGCTGCCTAGGTTGG - Intergenic
918760960 1:188406457-188406479 AACTAGAAAACTGCATTGCTTGG + Intergenic
919274902 1:195401264-195401286 AAGAAGAAGAATGGCTTGGTTGG + Intergenic
919629120 1:199942871-199942893 TAGGAGAAAAATGCCTTGGATGG + Intergenic
919634581 1:199991022-199991044 AAAGAGTACACTGACTTGGTCGG - Intergenic
920578667 1:207083932-207083954 AAGTAGCAACCTGCCTTAGTAGG + Intronic
1063548201 10:7002355-7002377 CAGGAGAACACTGTGTTGGTGGG - Intergenic
1064997226 10:21306999-21307021 AAGAAGACAACTTCCTTGGCTGG + Intergenic
1065143561 10:22743717-22743739 AAGGAAAAAACTGCATGGGTTGG - Intergenic
1067680315 10:48431737-48431759 AAGAAGAAAACTGGGTTTGTAGG + Intronic
1068773545 10:60848514-60848536 GAGAAGGAATCTGCCTTGGTGGG - Intergenic
1068928365 10:62563392-62563414 AAGGGGAGAAATCCCTTGGTGGG + Intronic
1069281723 10:66662831-66662853 AAGGAGAAAAATGCCTCCTTTGG + Intronic
1069688746 10:70335687-70335709 AAGGAGTCATCTGCCTGGGTGGG - Intronic
1071443524 10:85725493-85725515 GAGGAGAAAACTGCCAAGTTTGG + Intronic
1072197228 10:93126567-93126589 AGGGAGAACACAGCCTGGGTGGG + Intergenic
1073522393 10:104145462-104145484 AAGGAGAAACAAACCTTGGTCGG + Exonic
1074736382 10:116438414-116438436 TAGGAGAAGACTGCCCTGGCTGG - Intronic
1076583437 10:131530260-131530282 AAGGGGAAATGGGCCTTGGTGGG - Intergenic
1077418558 11:2437343-2437365 GGTGAGAAAATTGCCTTGGTGGG + Intergenic
1077941753 11:6850574-6850596 AAGGTGAAAAATGGCTTGATAGG + Intergenic
1080655383 11:34253865-34253887 GAAGAGAAAACTTCCTTGTTTGG + Intronic
1083937839 11:65879748-65879770 AAGGGGAAGACAGGCTTGGTGGG - Intergenic
1086420694 11:86634308-86634330 AAGGAGAAGACAGTCCTGGTGGG - Intronic
1090277106 11:125427997-125428019 AAGGAGAGAAATGCAGTGGTGGG - Intronic
1091698151 12:2641824-2641846 GAGTAGAAAACAGCCTTTGTGGG - Intronic
1092497174 12:9008310-9008332 AAGGAGAAAATTGCAATGGAAGG + Intronic
1095669363 12:44840445-44840467 AAGGAAAAAAGAGCCTTGCTTGG - Intronic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1098244055 12:68498172-68498194 AAGGAGAAACTTGCGTTGTTCGG - Intergenic
1098455315 12:70666182-70666204 TAGGGGAAAATTGCCTTGGGGGG + Intronic
1098617963 12:72553744-72553766 AAGGAGGAAATTGCCTGGGTGGG - Intronic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1101226352 12:102691792-102691814 AAAGAAAAAACTGACTTGGATGG - Intergenic
1103298498 12:119908471-119908493 AGAGAGAAAACTGCCTTGGAAGG - Intergenic
1103753437 12:123183575-123183597 AAGGAAAAAAGTGCCTTAGCAGG + Intronic
1105348739 13:19597627-19597649 GAGGACTAGACTGCCTTGGTAGG + Intergenic
1105740538 13:23318404-23318426 AAGAAGAAAACTGCCATGATGGG + Intronic
1107245043 13:38283668-38283690 AAACAGAAAACTGGCATGGTTGG + Intergenic
1108035301 13:46284928-46284950 AAGTAAAGCACTGCCTTGGTGGG - Intergenic
1109093952 13:58087069-58087091 AAGTGGAAAACTTCATTGGTTGG - Intergenic
1111256568 13:85677250-85677272 GAGGACTAAACTGCCTTTGTAGG - Intergenic
1111303902 13:86381948-86381970 AAGGACTAGACTGCCTTTGTAGG + Intergenic
1112176138 13:97026961-97026983 AAGGAGAGAATTCCCTTGTTAGG + Intergenic
1113907752 13:113827886-113827908 AAGGGGAAAACAGCCATGATGGG - Intronic
1114382331 14:22220491-22220513 AAGGAGAAAAATGCCCAGGGAGG + Intergenic
1114752438 14:25219999-25220021 CAGGAGAAAGCAGCCCTGGTTGG + Intergenic
1115517569 14:34201065-34201087 AAGCAGAAAACTTCCCTGGTTGG + Intronic
1116658783 14:47681583-47681605 AAGGTAAAAACTGCCCTGGTGGG - Intergenic
1117818731 14:59625944-59625966 AATGGGAAAACTGCCTTAGCTGG - Intronic
1118036692 14:61875942-61875964 AAGGTGACCACTGCCTTGTTAGG + Intergenic
1119138425 14:72242317-72242339 TAGGAGGAAACTGCCTTTGAGGG + Intronic
1120412837 14:84178690-84178712 AAGAAGAAAGCTGCCATGTTGGG - Intergenic
1121119191 14:91365190-91365212 AAGGTGAAACCTGCCTGGGAGGG - Intronic
1122247026 14:100410517-100410539 ATGGAGAAAAATGGCTGGGTGGG + Intronic
1122711384 14:103660924-103660946 AAGAAGAAAACTGGTTTCGTAGG + Intronic
1202856889 14_GL000225v1_random:57652-57674 AGGGAGAAAACGGCCTGGGAGGG - Intergenic
1126332328 15:47546690-47546712 AAGGAGAAACCCACCATGGTGGG + Intronic
1130010561 15:80150399-80150421 AATGAGAAGACTACATTGGTGGG + Intergenic
1130689308 15:86066718-86066740 ACGGATAAAACAGCCTGGGTGGG + Intergenic
1131934900 15:97492559-97492581 AAGCAGAAAACTGCTTTAGCTGG + Intergenic
1132000260 15:98172305-98172327 AAGGTGAAAAATGCACTGGTTGG - Intergenic
1134389283 16:13804329-13804351 GAGGAGAAGACTGCCTGGGTTGG - Intergenic
1135174379 16:20215174-20215196 AAAGAGAAAGCTCCCTTTGTTGG + Intergenic
1136857614 16:33673191-33673213 AAGGAGTTAACTACGTTGGTGGG + Intergenic
1140823799 16:78686849-78686871 AAGAAGAACACTGCCTTCCTGGG - Intronic
1203119193 16_KI270728v1_random:1521674-1521696 AAGGAGTTAACTACGTTGGTGGG + Intergenic
1144355376 17:14440806-14440828 CAGGAGAAAACTGCCCTGCCTGG - Intergenic
1144740035 17:17576631-17576653 CAGGAGAACGCTGCCATGGTGGG - Intronic
1147888925 17:43703606-43703628 ATGCAGAAAACAGCCTTGTTGGG - Intergenic
1148221803 17:45868150-45868172 GAGGACTAAACTGCCTTTGTAGG + Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149228966 17:54509894-54509916 AAACTGAAAACTGCCTTGGAAGG + Intergenic
1150983771 17:70172069-70172091 AAGCAGAAAACTTCCTTGCCCGG - Intronic
1151100543 17:71551029-71551051 AAGGTGAAAACTGCCTCCATTGG - Intergenic
1152030645 17:77840483-77840505 AAGGAGATTCCTGCCTTGGAAGG - Intergenic
1152804545 17:82348869-82348891 AAAGAGAAACCTGCCATAGTGGG + Intergenic
1153047779 18:872217-872239 AGGGAGAAACCTGCCTTGTTGGG + Intergenic
1155615954 18:27721635-27721657 AATGAGAAAACAGCCTTAGGTGG - Intergenic
1157228193 18:45887774-45887796 AAGTAAAGAACTGCCTTGTTGGG + Exonic
1159464226 18:68759904-68759926 ATGAAGAAAACTGCTTTGTTTGG + Intronic
1160971951 19:1773223-1773245 ATGGAGAAAAATGGTTTGGTGGG - Intronic
1161958679 19:7510437-7510459 TGGGAGAGAACTGCCCTGGTTGG + Intronic
1162881521 19:13663201-13663223 TCAGAGAAAAATGCCTTGGTTGG - Intergenic
1164043624 19:21514170-21514192 AAGGAAAAAACTTCATTAGTTGG - Intronic
1165259466 19:34599507-34599529 AAGGGGAAACCTGTCTTGCTTGG - Intronic
1165494082 19:36141736-36141758 ATGGAGAAAAATGCCCTGGTAGG + Intronic
1165695196 19:37895469-37895491 AAGAAGGAAACTGCCTAGGCCGG + Intronic
1165996716 19:39848824-39848846 AAGGAGAAAACAGCCCCGCTTGG - Intergenic
925472571 2:4178502-4178524 AAGAATAAAACTAACTTGGTGGG + Intergenic
925691281 2:6525825-6525847 AAAGACAAAATTGCCTTGGAAGG - Intergenic
926079355 2:9971745-9971767 AACAAGAAAACTTCCTTGATTGG + Intronic
927306618 2:21580857-21580879 AAAGAGACAACTGCCTGGGTGGG + Intergenic
928661421 2:33505878-33505900 TAGGAGAATACCCCCTTGGTGGG + Intronic
930216403 2:48701624-48701646 GAGGAGAAAACTCATTTGGTTGG - Intronic
930699094 2:54441182-54441204 AAGGAGATAAGTACCTTGTTAGG - Intergenic
933742432 2:85545094-85545116 ATGGAGAAAGCTGACTTGGCTGG + Exonic
935030081 2:99313212-99313234 AAGAAGAAAAAAGACTTGGTTGG - Intronic
936499359 2:113053719-113053741 AATAAGAAAACTGGCTTGGCTGG + Intergenic
936499669 2:113056167-113056189 AATGAGAAAACTGGCTTGGCTGG + Intergenic
936953078 2:117997801-117997823 AATGAGCCAACTGCCTTAGTTGG - Intronic
938087747 2:128412406-128412428 AAGGAGCAAACTGCCCAGGAGGG - Intergenic
938215076 2:129504476-129504498 AAAGAGAAACCTTCCTTGGCTGG - Intergenic
939437641 2:142199360-142199382 AAGGAGACTACTGCCATTGTTGG - Intergenic
939618952 2:144394745-144394767 AAAAAGAAAACTGTATTGGTTGG + Intronic
941389636 2:164895666-164895688 AAGAAGTAAACTGCCTTGCCTGG - Intergenic
942486449 2:176444896-176444918 CAGGAGAAAACAGCTGTGGTAGG + Intergenic
943078243 2:183224424-183224446 AAGGACAAAACTTCCTAGGGAGG + Intergenic
943626416 2:190206160-190206182 AGGAAGAAGACTGCCTTGGTAGG + Intronic
944634596 2:201662757-201662779 AAGAAGAAAATTGCCTTAATTGG + Intronic
946032567 2:216716696-216716718 AAGAAGAAAAATGCCTTGGCAGG - Intergenic
948107715 2:235428413-235428435 CAGGAGAATGCTTCCTTGGTTGG - Intergenic
1170860967 20:20103045-20103067 ATGGAGAAAGCTGACTTGGCTGG + Intronic
1173618220 20:44416578-44416600 AAAGAGGAAACTGCCTGGGAGGG - Intronic
1173632300 20:44525834-44525856 AAGGAGAATACAGAGTTGGTGGG + Intergenic
1175668517 20:60880803-60880825 ATGGTGAAAACTGCCTTGAGAGG - Intergenic
1175817011 20:61888408-61888430 AAGGAGAACACAGCCAGGGTGGG + Intronic
1176043152 20:63076734-63076756 TAGAAGAAAACTGCTGTGGTTGG - Intergenic
1178560489 21:33634956-33634978 TAGGTGAAAATTGCCCTGGTTGG + Intronic
1179112473 21:38459205-38459227 AAGGGTGAAACTGCCTTGGAGGG + Intronic
1179401907 21:41091993-41092015 AAGCAGAAATCAGCCTTGTTTGG + Intergenic
1180970774 22:19814196-19814218 AAGTAGAAATCTGCCATGGCTGG + Intronic
1181968973 22:26675842-26675864 AGGGAAAAATATGCCTTGGTGGG + Intergenic
1182681980 22:32086502-32086524 AAGGAGACATATGACTTGGTTGG + Intronic
1184548138 22:45187430-45187452 AAAGAGAAAACTGCCTTTTCTGG + Exonic
1185120291 22:48962295-48962317 AAGGAGGAAAGGGCCTAGGTTGG - Intergenic
951698259 3:25468322-25468344 AAGAAGAAAACTACCCTTGTTGG + Intronic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
955369280 3:58337098-58337120 AAGGAGAAAACTGCCAGGCATGG - Intronic
955673973 3:61430879-61430901 AAGGTGACCACTGCATTGGTTGG - Intergenic
956543674 3:70374571-70374593 ACTGATAATACTGCCTTGGTTGG + Intergenic
956799364 3:72743044-72743066 CAGTAGAATACTGCCTGGGTTGG + Intergenic
957271054 3:78030349-78030371 AACTTGAAAACTGCCTTGGGTGG - Intergenic
957314679 3:78562059-78562081 AGGGAGGAAACTGCCCTGGTGGG + Intergenic
957406744 3:79781400-79781422 AAGAAGAAAACTGACTTGCTGGG - Intergenic
957777402 3:84771384-84771406 AAGGAGAAAACTGCAATATTTGG - Intergenic
959242987 3:103823430-103823452 AAGGAGAAAACTACCATGTGAGG + Intergenic
959816951 3:110684824-110684846 AAGGACAAAACTGACTTTTTCGG - Intergenic
960186539 3:114647252-114647274 AAGTATAAAACTGCCTTGGCCGG - Intronic
962416407 3:135186555-135186577 AAGTCAAAAACTGCCTTGGGGGG - Intronic
962477302 3:135766418-135766440 AAGGAAAAAATTGCCCTCGTGGG + Intergenic
962767552 3:138579620-138579642 AAGGAGCCCACTGCCTTGGAGGG + Intronic
964815264 3:160710616-160710638 AAAGAGAAAACTGGCTTGGGTGG + Intergenic
965453331 3:168866294-168866316 AAGGAAAAAACAGGCTTGGAAGG - Intergenic
965460099 3:168951904-168951926 AACCAGAAAACTGCATGGGTTGG + Intergenic
966322009 3:178711471-178711493 AGGTAGAAATCTGTCTTGGTGGG - Intronic
967378779 3:188834499-188834521 AAGCAGGCAACTTCCTTGGTGGG - Intronic
967745819 3:193053820-193053842 AAGGATAACACTGGCTTGGTAGG - Intergenic
969265316 4:6060701-6060723 AAGAAGAGAACAGCCTTGTTTGG + Intronic
971232160 4:24808635-24808657 AAGAAGTAAACAGCCTTGGGAGG - Exonic
971356000 4:25895803-25895825 AAGGAGAAAACTTGCTTCTTTGG - Intronic
972512917 4:39786338-39786360 AAGGATAAAAGTGCCTATGTGGG + Intergenic
972601393 4:40576018-40576040 AAGGAGAACCCTGCCTTGGGTGG - Intronic
972847851 4:43011228-43011250 AAGGAGAAAACGGACCTGGAAGG - Intronic
973255658 4:48109764-48109786 AATGAGAGAACCTCCTTGGTTGG - Intronic
974373178 4:61043466-61043488 AGGAACCAAACTGCCTTGGTAGG + Intergenic
980159979 4:129149189-129149211 AAGGAGAAAACCTGCTTGGTCGG - Intergenic
980626611 4:135381436-135381458 AGGGACTAAACTGCCTTTGTAGG + Intergenic
981028723 4:140102418-140102440 CAGGAGAAACCAGCCTTGCTTGG - Intronic
981174185 4:141661402-141661424 AAGGAGAGAAATGCATTGGAAGG + Intronic
982750189 4:159151855-159151877 AATGAGAAAAGGGCATTGGTAGG + Intronic
982822544 4:159960714-159960736 CAGGAGAAAACTACTTTGTTAGG - Intergenic
985209454 4:187576802-187576824 AAGGAGGAAACTGACTCTGTAGG + Intergenic
987832702 5:23117426-23117448 ATGGAGAAAACTGACCAGGTGGG - Intergenic
989106571 5:37868577-37868599 AAGATGAAATCTGCCATGGTGGG - Intergenic
991172809 5:63648007-63648029 CAGCAGAAAACTACCTTGCTTGG - Intergenic
991291543 5:65037728-65037750 ATGGAGAAAACTGGCTTGGTTGG - Intergenic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
995589361 5:113683079-113683101 AAGAAGCAAACTGCCTTCCTGGG - Intergenic
996610304 5:125371071-125371093 AAAGAGAAAAATGCCCTGCTTGG + Intergenic
999574025 5:152953943-152953965 CAGGAGAAAGCTGCCTCTGTTGG - Intergenic
1000277174 5:159748196-159748218 AAGGAAAGAACTGGCTGGGTGGG - Intergenic
1001573543 5:172746882-172746904 GAGGACAAACATGCCTTGGTTGG - Intergenic
1004049999 6:12067760-12067782 AAGGAAACAACTGCTCTGGTAGG + Intronic
1005939863 6:30552928-30552950 AAGGAGCAGACTGACTTGGTGGG - Intronic
1006563141 6:34931133-34931155 AAAAAGAAAACAGCCTTGGGAGG - Intronic
1006874421 6:37282855-37282877 AAATAGAAAACAGCCTTGTTAGG - Intronic
1007982072 6:46170239-46170261 CAGGAGAAAACTGCTTTCTTGGG + Intronic
1008416515 6:51247202-51247224 AAGGAGGAAATGGCATTGGTAGG - Intergenic
1008962157 6:57277015-57277037 AAGGAGAAGACCACCTTGGAAGG + Intergenic
1009414478 6:63400239-63400261 AATGAGAAAACTTGCTTGGCAGG + Intergenic
1010243273 6:73637616-73637638 AAGTGGAAAACTACCTTGGATGG - Intronic
1011450277 6:87484378-87484400 TAGAAGGAAACTGCCTTGCTGGG - Intronic
1013702522 6:112790543-112790565 AAGTAGAAAAGTGACATGGTCGG - Intergenic
1013924918 6:115460440-115460462 AACAAGAATACTGCCTTGATGGG - Intergenic
1013925002 6:115461669-115461691 AATGAGAAAAATTCTTTGGTTGG - Intergenic
1014383620 6:120775041-120775063 GATGAGAATACTGCCTTGTTTGG - Intergenic
1017386357 6:153889422-153889444 AATGATAATATTGCCTTGGTTGG + Intergenic
1017910666 6:158789914-158789936 AAGAAAAAAACTGCTTAGGTTGG - Intronic
1020082261 7:5292670-5292692 AAGGAAAAAAATGTCTTGGCTGG - Intronic
1020937572 7:14486465-14486487 ATAGAGAAAACGGCCTTGGGAGG + Intronic
1021408756 7:20304448-20304470 AAGGAGAAAGGTGCCTGGGTGGG - Intergenic
1022467491 7:30661414-30661436 AAGAAGAGGGCTGCCTTGGTAGG - Intronic
1023409097 7:39870367-39870389 AAGCAGAATACTGACTTGGCAGG + Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1025043834 7:55673661-55673683 AAGCAGAATACTGACTTGGCAGG - Intergenic
1030806784 7:113929522-113929544 CAGGAGAAAAGTGGTTTGGTGGG + Intronic
1031205096 7:118746459-118746481 AAGGAAAAACCTGCATTCGTAGG + Intergenic
1031304475 7:120108999-120109021 AAGGAGAGACCTGGCATGGTGGG - Intergenic
1034143052 7:148840643-148840665 TAGTATAAAACTGCCTTGTTGGG + Intronic
1034931408 7:155166679-155166701 AAACAGAAAACTGTCTTGTTTGG + Intergenic
1035520373 8:271321-271343 CGGGAGGAAACAGCCTTGGTAGG - Intergenic
1036574444 8:10013162-10013184 AGGGAGAACAGTGCCTTGTTAGG - Intergenic
1038900882 8:31842401-31842423 AAGCAACAAACTGACTTGGTGGG + Intronic
1039008547 8:33068263-33068285 GAGGCAAAAACTGCCTGGGTGGG + Intergenic
1040386310 8:46917159-46917181 GAGGAGTAAACTGCCTTTGTAGG + Intergenic
1040747680 8:50665157-50665179 AAGGAGAAAACATGCTTGGCAGG + Intronic
1042570332 8:70156837-70156859 CAGGGGAAAACTGACTGGGTGGG + Exonic
1042769019 8:72358565-72358587 AAGAAGCAAGCTGCCTTGTTAGG - Intergenic
1045811888 8:106231534-106231556 AAAGACAAAAATGCCTTTGTGGG + Intergenic
1047033547 8:120910586-120910608 AACCTGAAAACTGGCTTGGTAGG - Intergenic
1048031870 8:130640761-130640783 AAGGAGGCGAGTGCCTTGGTAGG - Intergenic
1048400947 8:134069944-134069966 AAGAAGAAAACTGGCCTCGTGGG - Intergenic
1051107588 9:13597570-13597592 AAGGAAATAGCTGCCTTGGAGGG + Intergenic
1056053839 9:82799942-82799964 AAGGAGGAGACTTTCTTGGTAGG - Intergenic
1057329195 9:94096794-94096816 AAAGAAGAAACTGCCGTGGTAGG + Intronic
1060983253 9:127805691-127805713 AAGGAGAAAATTGCCTTGCAAGG + Intronic
1061313384 9:129778417-129778439 AAGGAGAAATCTGCCTTCCTGGG - Intergenic
1186108188 X:6227854-6227876 AAAGGGAAAACCGGCTTGGTTGG - Intronic
1186369442 X:8931426-8931448 AATGAGATTACTGCCTTGTTAGG + Intergenic
1187608392 X:20912408-20912430 ACTGAGAACACTGTCTTGGTAGG - Intergenic
1192734516 X:73836431-73836453 AGTGAGAAACCTGGCTTGGTTGG - Intergenic
1192776766 X:74253755-74253777 AAGAAGAAAAGTGTCTTGCTGGG - Intergenic
1193756799 X:85418828-85418850 AAGGAAAACACTGCCTTGAAGGG - Intergenic
1195107838 X:101617513-101617535 AAGGAGAAAACTGCCTTGGTTGG - Exonic
1195770801 X:108349021-108349043 AAGTTGAAATCAGCCTTGGTGGG + Intronic
1199331708 X:146568118-146568140 CAGGAGAAATGCGCCTTGGTGGG + Intergenic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1200168243 X:154052248-154052270 AAGGACAAGCCTGCCTTGTTGGG + Intronic