ID: 1195116438

View in Genome Browser
Species Human (GRCh38)
Location X:101703667-101703689
Sequence TCACTTCTCTTTCCAGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195116438_1195116446 -6 Left 1195116438 X:101703667-101703689 CCAGAGGCTGGAAAGAGAAGTGA No data
Right 1195116446 X:101703684-101703706 AAGTGAGAGGTTTGGGGGAGGGG No data
1195116438_1195116451 12 Left 1195116438 X:101703667-101703689 CCAGAGGCTGGAAAGAGAAGTGA No data
Right 1195116451 X:101703702-101703724 AGGGGAGTGGGGATCATTAAGGG No data
1195116438_1195116449 1 Left 1195116438 X:101703667-101703689 CCAGAGGCTGGAAAGAGAAGTGA No data
Right 1195116449 X:101703691-101703713 AGGTTTGGGGGAGGGGAGTGGGG No data
1195116438_1195116447 -1 Left 1195116438 X:101703667-101703689 CCAGAGGCTGGAAAGAGAAGTGA No data
Right 1195116447 X:101703689-101703711 AGAGGTTTGGGGGAGGGGAGTGG No data
1195116438_1195116448 0 Left 1195116438 X:101703667-101703689 CCAGAGGCTGGAAAGAGAAGTGA No data
Right 1195116448 X:101703690-101703712 GAGGTTTGGGGGAGGGGAGTGGG No data
1195116438_1195116452 13 Left 1195116438 X:101703667-101703689 CCAGAGGCTGGAAAGAGAAGTGA No data
Right 1195116452 X:101703703-101703725 GGGGAGTGGGGATCATTAAGGGG No data
1195116438_1195116445 -7 Left 1195116438 X:101703667-101703689 CCAGAGGCTGGAAAGAGAAGTGA No data
Right 1195116445 X:101703683-101703705 GAAGTGAGAGGTTTGGGGGAGGG No data
1195116438_1195116450 11 Left 1195116438 X:101703667-101703689 CCAGAGGCTGGAAAGAGAAGTGA No data
Right 1195116450 X:101703701-101703723 GAGGGGAGTGGGGATCATTAAGG No data
1195116438_1195116444 -8 Left 1195116438 X:101703667-101703689 CCAGAGGCTGGAAAGAGAAGTGA No data
Right 1195116444 X:101703682-101703704 AGAAGTGAGAGGTTTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195116438 Original CRISPR TCACTTCTCTTTCCAGCCTC TGG (reversed) Intergenic
No off target data available for this crispr