ID: 1195116743

View in Genome Browser
Species Human (GRCh38)
Location X:101706961-101706983
Sequence ATAGAGTAGTAGCCAGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195116738_1195116743 -9 Left 1195116738 X:101706947-101706969 CCAAAGCATTGAAGATAGAGTAG No data
Right 1195116743 X:101706961-101706983 ATAGAGTAGTAGCCAGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195116743 Original CRISPR ATAGAGTAGTAGCCAGGGGC GGG Intergenic
No off target data available for this crispr