ID: 1195121235

View in Genome Browser
Species Human (GRCh38)
Location X:101755124-101755146
Sequence CTGGTACCTCAGATGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195121235_1195121241 2 Left 1195121235 X:101755124-101755146 CCCTGCACCATCTGAGGTACCAG No data
Right 1195121241 X:101755149-101755171 AATCTGTGTCTTAGCATAAGGGG No data
1195121235_1195121240 1 Left 1195121235 X:101755124-101755146 CCCTGCACCATCTGAGGTACCAG No data
Right 1195121240 X:101755148-101755170 CAATCTGTGTCTTAGCATAAGGG No data
1195121235_1195121239 0 Left 1195121235 X:101755124-101755146 CCCTGCACCATCTGAGGTACCAG No data
Right 1195121239 X:101755147-101755169 TCAATCTGTGTCTTAGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195121235 Original CRISPR CTGGTACCTCAGATGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr