ID: 1195122992

View in Genome Browser
Species Human (GRCh38)
Location X:101775370-101775392
Sequence AAGCCCCCATTCCAAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195122992_1195122995 19 Left 1195122992 X:101775370-101775392 CCTAGGGCTTGGAATGGGGGCTT No data
Right 1195122995 X:101775412-101775434 CTATCCTGCTGTGACTGAGCTGG 0: 10
1: 136
2: 364
3: 572
4: 874

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195122992 Original CRISPR AAGCCCCCATTCCAAGCCCT AGG (reversed) Intergenic
No off target data available for this crispr