ID: 1195124090

View in Genome Browser
Species Human (GRCh38)
Location X:101787677-101787699
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195124090_1195124093 4 Left 1195124090 X:101787677-101787699 CCTTAATCAGTTTATGTATCCAA No data
Right 1195124093 X:101787704-101787726 TAGGAATAATAGTTCATGCTCGG No data
1195124090_1195124094 17 Left 1195124090 X:101787677-101787699 CCTTAATCAGTTTATGTATCCAA No data
Right 1195124094 X:101787717-101787739 TCATGCTCGGCATACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195124090 Original CRISPR TTGGATACATAAACTGATTA AGG (reversed) Intergenic
No off target data available for this crispr