ID: 1195128903

View in Genome Browser
Species Human (GRCh38)
Location X:101836076-101836098
Sequence CTGTGCTCCTAGGAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195128896_1195128903 -10 Left 1195128896 X:101836063-101836085 CCTGCACCATTTCCTGTGCTCCT 0: 1
1: 0
2: 13
3: 137
4: 440
Right 1195128903 X:101836076-101836098 CTGTGCTCCTAGGAGAGGGAGGG 0: 1
1: 0
2: 2
3: 41
4: 338
1195128894_1195128903 10 Left 1195128894 X:101836043-101836065 CCCAGACTGGGCAGAGAAAGCCT 0: 3
1: 1
2: 0
3: 24
4: 255
Right 1195128903 X:101836076-101836098 CTGTGCTCCTAGGAGAGGGAGGG 0: 1
1: 0
2: 2
3: 41
4: 338
1195128895_1195128903 9 Left 1195128895 X:101836044-101836066 CCAGACTGGGCAGAGAAAGCCTG 0: 3
1: 1
2: 2
3: 26
4: 286
Right 1195128903 X:101836076-101836098 CTGTGCTCCTAGGAGAGGGAGGG 0: 1
1: 0
2: 2
3: 41
4: 338
1195128891_1195128903 25 Left 1195128891 X:101836028-101836050 CCACTCTAGTTTCATCCCAGACT 0: 1
1: 2
2: 0
3: 21
4: 178
Right 1195128903 X:101836076-101836098 CTGTGCTCCTAGGAGAGGGAGGG 0: 1
1: 0
2: 2
3: 41
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195128903 Original CRISPR CTGTGCTCCTAGGAGAGGGA GGG Intronic
900745072 1:4355591-4355613 ATGTGCTCCCAGGAGAGGCACGG + Intergenic
900966474 1:5962394-5962416 CTGTGCTCTCAGGAGACTGAGGG - Intronic
901414197 1:9105634-9105656 CGGTGCTCCTGGGAGAGGATGGG + Exonic
903836201 1:26204670-26204692 CTGAGCTCCTAGGACAGTGCGGG + Intergenic
903996520 1:27308189-27308211 CTCCGCTCCCAGGAGAGTGAGGG + Exonic
904325306 1:29724191-29724213 CTCTCCTCCCAGGAGAGGAATGG + Intergenic
904615310 1:31746368-31746390 CTGTGGTCCCAAGAGAGGCAGGG - Intronic
905330430 1:37191439-37191461 TTGTGGTCCAAGGAGAGGAAAGG + Intergenic
906606962 1:47179556-47179578 CTGTGCACCCAGGACAGGGCTGG - Intergenic
906892207 1:49729839-49729861 CTGTCTGCCTAGGACAGGGATGG - Intronic
906924059 1:50095332-50095354 CTGTTCTCCTAGTTGGGGGAAGG - Intronic
906951753 1:50340708-50340730 CTGTGATTCTAGAAGAGGGATGG - Intergenic
907451437 1:54548103-54548125 CAGGGCTCCTAGGAGAAGGGGGG + Intronic
910258826 1:85276601-85276623 CTGAGCCTCTACGAGAGGGAAGG - Exonic
911011606 1:93287165-93287187 CTGTGCTCTTGGGGGAGAGAAGG + Intergenic
912517359 1:110224794-110224816 CTGGGCTCCTGGGAAAGGTATGG + Intronic
912955091 1:114149845-114149867 CAGTGCTCCTAGAAGAAAGAAGG + Intronic
913163292 1:116164642-116164664 GTGGGCTCTTAGGAGAGGAATGG + Intergenic
913163621 1:116166689-116166711 GTGGGCTCTTAGGAGAGGAATGG + Intergenic
913484241 1:119319309-119319331 CTGTGCTACTAACAGAGGTATGG - Intergenic
915146050 1:153796297-153796319 TTGTGCTCCCAGGAAATGGATGG - Intergenic
915167555 1:153956928-153956950 CTGTGATTCTAGCAGAGGCATGG - Intronic
916307772 1:163358640-163358662 CTTTGGTCATAGGAGAGTGATGG - Intergenic
916371957 1:164108244-164108266 CTGGGCTCTTATGAGAGGAAAGG + Intergenic
919935658 1:202248915-202248937 CTCGGCTCCCAGGATAGGGAGGG - Intronic
921731270 1:218581166-218581188 CTGACCTCCTGGGAGAGGAAAGG - Intergenic
922290165 1:224203259-224203281 CTGTGTTCCTGGGAGTGGGACGG - Intergenic
922660967 1:227429992-227430014 CTGTGCTGCTGTGACAGGGAAGG + Intergenic
922901322 1:229138910-229138932 CTGTGCCCAGAGGAGAGGGAAGG - Intergenic
923161410 1:231317671-231317693 CTGGGCTTCTAGGAGAGGTGGGG + Intergenic
924350494 1:243109653-243109675 CTGTGCGCCTGAAAGAGGGAGGG - Intergenic
1062777811 10:169003-169025 TTGTGCTTCTTGGAGCGGGAGGG + Intronic
1062842514 10:681913-681935 CTCTGCTCCTAGGAGATACACGG - Intronic
1063430989 10:5988090-5988112 CTGTGCTCTTAGGAGGATGATGG - Intergenic
1063832597 10:9972069-9972091 TTGTGCTCCCAGCAGTGGGAAGG + Intergenic
1064413024 10:15124694-15124716 CTGGGCCCATAGGAGAGGAAGGG + Intronic
1065865531 10:29911720-29911742 CTGTGCTCCTCGGGGTGGGGTGG + Intergenic
1066040422 10:31543731-31543753 CTGACCTCCTGGGAGAGGAATGG + Intergenic
1066421886 10:35271455-35271477 CTGTGCTTCTGGCAGGGGGAAGG + Intronic
1067531934 10:47080518-47080540 CTCTGCTCCTAGGGGAGGCTGGG - Intergenic
1069921839 10:71820212-71820234 CTGTCCTCCTGGCAGAGGGAGGG - Intronic
1070618494 10:77988024-77988046 CTGGGCTCCTGGGAGACAGACGG - Intronic
1070833051 10:79432044-79432066 CTGTGCTCCCAGGATAGGGCTGG - Intronic
1071301721 10:84261229-84261251 CTGTGCTCAGAGGAGAGGCAGGG + Intergenic
1075145077 10:119875759-119875781 CTGTCCTCCAGGAAGAGGGAGGG + Intronic
1075257686 10:120938707-120938729 CTGTCCTCCTGGTGGAGGGATGG + Intergenic
1075262585 10:120976071-120976093 CTGTGGTCCCAGGAAACGGAAGG - Intergenic
1075402255 10:122169729-122169751 CAGTGCTCAGATGAGAGGGAAGG - Intronic
1076726121 10:132414137-132414159 CTCTGCTGCCGGGAGAGGGAAGG + Intronic
1077285251 11:1762728-1762750 CTGTCCTCCTTGGAGAGGGGAGG + Intronic
1077370582 11:2179891-2179913 CTGTGCTCCTGAGGGCGGGAAGG + Intergenic
1078565845 11:12413339-12413361 CTGTGCTCCAGGGGAAGGGAAGG + Intronic
1078768168 11:14319662-14319684 CTGTGCTCTTAGAAGACAGAGGG - Intronic
1080658070 11:34273602-34273624 CAGACCTCCGAGGAGAGGGATGG + Intronic
1081979806 11:47259272-47259294 CTGGGCTCAGGGGAGAGGGATGG - Intronic
1081984383 11:47290915-47290937 CTTTGCTTCTTAGAGAGGGAAGG + Intronic
1082820038 11:57538505-57538527 CTGTGCACCTAGAAGAAAGAGGG + Intergenic
1083334793 11:61916431-61916453 CTGCGATGCTAGGGGAGGGATGG - Intronic
1084743635 11:71154793-71154815 CCATGCTCCCAGAAGAGGGATGG + Intronic
1084782916 11:71422943-71422965 CAGAACTCTTAGGAGAGGGATGG - Intergenic
1084991055 11:72925968-72925990 CTGTGCTCCTGGGGGAGGGCCGG + Intronic
1085274845 11:75291851-75291873 CTGTGCTCCTGGGGGAGGACTGG - Intronic
1086993752 11:93333398-93333420 CTGTGCTCCTTCCATAGGGAAGG + Intronic
1088231370 11:107676735-107676757 CTTTGGCCCCAGGAGAGGGATGG - Intergenic
1088395230 11:109360692-109360714 CTGAGCTCTTAGGAAAGTGAAGG - Intergenic
1089401101 11:118165123-118165145 CTGGGCTCCTGGGAGGGGGCAGG + Exonic
1090432082 11:126654584-126654606 CTGTGCTCTGGGGTGAGGGAAGG - Intronic
1090841292 11:130489567-130489589 CACTGATTCTAGGAGAGGGAAGG + Intergenic
1091369142 11:135044342-135044364 CTGAGCTCCAGGGAGTGGGAGGG - Intergenic
1092204813 12:6608205-6608227 CTGTGGAGCTAGAAGAGGGAAGG - Intergenic
1092218427 12:6697832-6697854 CTGTGGGCCTATGTGAGGGAGGG + Intronic
1093140956 12:15509781-15509803 CTGTGCACAGAGGAGAGTGAGGG + Intronic
1093545331 12:20338505-20338527 GTGTATTCCTAAGAGAGGGATGG - Intergenic
1094067913 12:26381045-26381067 CTGCTCTCCTAGCAGAGGGGTGG - Intronic
1094545556 12:31401402-31401424 CTGGGCTCCTGGGGGCGGGAGGG + Intronic
1095727404 12:45469115-45469137 CTGTGCTCTTGGGGGAGGGCCGG + Intergenic
1096984203 12:55745558-55745580 CTGAGCTCTTAAGAGAGGGAGGG + Intronic
1101482095 12:105107929-105107951 CAGCGCTCCTGCGAGAGGGACGG + Intronic
1101846915 12:108370114-108370136 CTTTGCTCCCAGGAGGGAGAAGG - Intergenic
1102111018 12:110365945-110365967 CTGTCCTCCTAGGGGAGGCCAGG - Intergenic
1102146618 12:110659392-110659414 CTCTGCTTCCAGAAGAGGGACGG + Intronic
1102327070 12:111995225-111995247 CTGTGGTACTAGTACAGGGATGG + Intronic
1102685680 12:114722725-114722747 CTATCCTCCTAGGAAATGGAAGG + Intergenic
1105402439 13:20107459-20107481 GTGGACTCCTAGGAGCGGGATGG - Intergenic
1105583328 13:21721290-21721312 CTGTGCTGCCAGGCGAGTGAGGG - Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1105884058 13:24627321-24627343 CTGGGCTCCTGGAAGAGGGGAGG + Intergenic
1106420813 13:29584252-29584274 CTGTAGTCCTAGCAGAGGGCTGG - Intronic
1106421823 13:29591682-29591704 CTGTGCCCCCAGAAAAGGGAGGG + Intronic
1106831878 13:33592999-33593021 GTGGGCACCTAGGAGAGGGGTGG + Intergenic
1107711561 13:43155187-43155209 GTGCGCTCCCAGGAGAGGGCAGG - Intergenic
1108220864 13:48232653-48232675 CTGACCTCCTGAGAGAGGGAAGG + Intergenic
1108220925 13:48233027-48233049 CGGCGCGCCTCGGAGAGGGATGG - Intergenic
1109202240 13:59443739-59443761 CTGTGCACCTAGCAGAGTGGGGG - Intergenic
1110376621 13:74801972-74801994 GTGTGCTCTTGGGAGAGGGAAGG + Intergenic
1111764668 13:92513150-92513172 CTGTTCTTCTAGGAGAAGGGCGG + Intronic
1113015281 13:105822287-105822309 CTGTGCTCAGGGGAAAGGGAAGG + Intergenic
1113576209 13:111396874-111396896 CTGTGCTCCTAGGAACGCTAAGG + Intergenic
1113724047 13:112584858-112584880 ATGTGCTCCCAGGAGGGGCAGGG + Intronic
1114023598 14:18503763-18503785 CTGGAATCCTAAGAGAGGGACGG - Intergenic
1115687169 14:35808664-35808686 AGGGGCTCCCAGGAGAGGGAAGG + Intronic
1118962287 14:70545326-70545348 CTGCGCACTTGGGAGAGGGATGG + Intergenic
1119559158 14:75576657-75576679 CTGTGCTCCCTGGAGAATGATGG + Intergenic
1119706356 14:76784988-76785010 CTCTTCTCCCAGGAGTGGGAGGG - Intergenic
1120987783 14:90349060-90349082 CTGCTCTCCTAAGAGAGGTAAGG - Intergenic
1122103220 14:99430208-99430230 CTGTGCACCCAGGGCAGGGAGGG - Intronic
1122268807 14:100559124-100559146 CTGCTCTCCCAGCAGAGGGACGG - Intronic
1122637740 14:103138316-103138338 CTGTGCTCCGAGGAGAGGAACGG - Intergenic
1122806355 14:104261603-104261625 CTGTGCTGCTGGGGGAGGCAGGG + Intergenic
1123006531 14:105326493-105326515 CTGAGCACCAAGGAGAGGGATGG + Intronic
1123627628 15:22238642-22238664 CTGTGCCCCGGGCAGAGGGAGGG - Intergenic
1124382422 15:29177790-29177812 CAGTGTTACTGGGAGAGGGAAGG + Intronic
1124691743 15:31829187-31829209 CTGTCCTCCAAGGAGAGGGAGGG - Intronic
1126318587 15:47397244-47397266 CTGTGCTCATAGTAGAGGTCAGG + Intronic
1126534035 15:49741593-49741615 CTGTGTTCTTGGGAGAGAGAAGG + Intergenic
1127147112 15:56035750-56035772 CTGTGCTCCTTGGGATGGGATGG + Intergenic
1127852316 15:62924610-62924632 GTTTGCTCCAAGGAGAGGGAAGG - Intergenic
1128550610 15:68595913-68595935 CTCTGAACCTAGGTGAGGGAAGG + Intronic
1129112418 15:73345217-73345239 CTGTGATTCAAGGAGAGGGTAGG + Intronic
1129368403 15:75071102-75071124 CCCTGCACCAAGGAGAGGGAAGG - Intronic
1129708394 15:77807603-77807625 CTGTGGTCCTGGGAGAGAAATGG - Intronic
1129838364 15:78727804-78727826 CACTCCTCCTAGGGGAGGGAGGG - Intergenic
1130065080 15:80596298-80596320 CTATGCTCCTAGGACAGAGCTGG - Exonic
1130453294 15:84079462-84079484 CTGTGTTCATAGGTGATGGAAGG + Intergenic
1131356768 15:91752131-91752153 ATGTGATCCCAGGAGAGGGGTGG - Intergenic
1131447195 15:92510270-92510292 CTGAGCTCTTGGGAGAGGTAGGG - Intergenic
1132021204 15:98364104-98364126 CTGGGCTGCTGGGAGAGGCAGGG + Intergenic
1134229510 16:12417971-12417993 CTGAGCTCCTGGGAAGGGGAAGG + Intronic
1134237738 16:12480766-12480788 CTGAGCTCTGAGGAGTGGGAGGG + Intronic
1135145892 16:19962461-19962483 CTGTTCTCCTAGGAGACGCTGGG - Intergenic
1135590474 16:23701515-23701537 ATGTGCTCCTGGGAGAGGTTTGG - Intronic
1136778065 16:32882080-32882102 CTTTGTTCCTAGGGGAGGGAGGG + Intergenic
1136892556 16:33979434-33979456 CTTTGTTCCTAGGGGAGGGAGGG - Intergenic
1140410365 16:74737445-74737467 CTCTGCTCAGAGGTGAGGGATGG - Intronic
1140522273 16:75592083-75592105 CTGGGGTCCAAGGAGTGGGAGGG - Intergenic
1140887639 16:79258883-79258905 CTGTGCGACTAGGGGAGGGAGGG + Intergenic
1142184935 16:88690339-88690361 CTGTGCTCTTGGGAGATGAAGGG + Intergenic
1203080484 16_KI270728v1_random:1144189-1144211 CTTTGTTCCTAGGGGAGGGAGGG + Intergenic
1142494418 17:298863-298885 CGGAGCTCCAAGGAGGGGGACGG + Intronic
1142738214 17:1915090-1915112 CTGTTCTCCTAGGAGAAAGCAGG - Intergenic
1142916344 17:3142395-3142417 CTGAGCTCCCAGGGGAGGGGTGG - Intergenic
1143883304 17:10047052-10047074 CTGTGCTGAGAGGAGAGGGCTGG - Intronic
1145228584 17:21152608-21152630 TTGTGCTTCCAGCAGAGGGAGGG + Intronic
1145795070 17:27650783-27650805 CTCTGCTGCTAGAAGAGGGAGGG + Intergenic
1145934280 17:28705844-28705866 CAGCACTCCTAGGGGAGGGAGGG + Intronic
1146406880 17:32546339-32546361 CAGAGCTCCTCGCAGAGGGATGG - Intronic
1146686161 17:34842918-34842940 CTGTGGGGCTAGGAGAGGGATGG - Intergenic
1147130641 17:38406020-38406042 CTGTGCTCTTCGGAGAGAAAGGG + Intergenic
1147369843 17:39984771-39984793 CTGTTGTTCTAGGAGAGAGAAGG + Intronic
1148742133 17:49898822-49898844 CTGTGCACACAGAAGAGGGATGG - Intergenic
1148854334 17:50570462-50570484 CTGTGGTCCTAGGAGTGGGGTGG + Intronic
1150159165 17:62880247-62880269 CTCTTCTCCTAGAATAGGGAGGG - Intergenic
1150831114 17:68520120-68520142 CTGTTCTCAAAGCAGAGGGAGGG + Intronic
1151322177 17:73358825-73358847 CTGTGCTGCTAGGAGGAGGGAGG + Intronic
1151680993 17:75622683-75622705 CAGTGGTCCCAGGTGAGGGATGG + Intergenic
1151909697 17:77073924-77073946 CTGTCATTCTAGTAGAGGGAGGG - Intergenic
1152029054 17:77830551-77830573 TGGTTCTCCAAGGAGAGGGAGGG - Intergenic
1152228449 17:79103255-79103277 CTGTGAGCAGAGGAGAGGGAAGG + Intronic
1152295841 17:79466473-79466495 CTGTGCTCCTTGGGGAGGGCAGG - Intronic
1152848562 17:82617653-82617675 CTGTGTGTCTGGGAGAGGGAAGG + Intronic
1153672833 18:7428796-7428818 CTGTGACCCAAGGAGTGGGATGG - Intergenic
1154214004 18:12402093-12402115 CAGTGCCCCTAGGACGGGGAGGG + Intergenic
1155152585 18:23135088-23135110 CTGTGCTCCTGGGAGAGTTGTGG - Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157446205 18:47748538-47748560 CTGTGTTCCTGTGAGAGGGGAGG + Intergenic
1158578726 18:58662749-58662771 CTGTCATCCCAGGAGTGGGAGGG + Intergenic
1159957846 18:74532596-74532618 CTGTGATCCTAGGAGGGTGGGGG - Intergenic
1160847281 19:1172196-1172218 CTCTCGTCCTTGGAGAGGGAAGG - Intronic
1161059677 19:2208639-2208661 CTCTGCTTCTGGAAGAGGGAGGG - Intronic
1161660349 19:5541927-5541949 CACTGATCCTAGTAGAGGGAGGG - Intergenic
1163034419 19:14562884-14562906 CTTTGCTCCTGGGAGAGTCATGG + Intronic
1163196054 19:15721033-15721055 TTGTGCACCAAGCAGAGGGAAGG - Intergenic
1163315045 19:16535809-16535831 CTGGGATCCTGTGAGAGGGAGGG - Intronic
1164177150 19:22785159-22785181 CTCTGACCTTAGGAGAGGGAAGG + Intergenic
1164512576 19:28909646-28909668 CTGTGTTCCAGGGAGAGGGAGGG + Intergenic
1165458144 19:35926898-35926920 CCGTGCTCCCAGAAGAGGAATGG + Intergenic
1165726276 19:38115184-38115206 CTGTGGCCCTGGGAGAGGGGCGG + Intronic
1165895641 19:39139393-39139415 CTGGGCTCCAAGGAGGGGGCTGG + Intronic
1166334327 19:42096152-42096174 CTGGGCTCCTCGGGGTGGGATGG + Exonic
1166828485 19:45624317-45624339 GTGTGATCCTAGGAAATGGATGG - Intronic
925038090 2:707208-707230 CAGTGACCCCAGGAGAGGGAGGG - Intergenic
925176186 2:1785521-1785543 CTGGCCTCCGAGGGGAGGGACGG + Intergenic
925392412 2:3505516-3505538 CTGTGCTTCTGGCAGAGGGAGGG + Intronic
925631961 2:5903564-5903586 GGGTGCTCCGAGGAGAGGCACGG + Intergenic
925751855 2:7096327-7096349 CTTTCCTCCAAGGAGAAGGAGGG + Intergenic
925943384 2:8839832-8839854 CTGTGCTACCAAGAGAGGGAGGG - Intergenic
926329399 2:11812366-11812388 CAGTGCTAGGAGGAGAGGGAAGG + Intronic
926520225 2:13901137-13901159 CTGAGGTCCTTGGAGAGGTATGG - Intergenic
927802295 2:26112272-26112294 CTGACCTCCTAGGAGGGGAAGGG - Intronic
927889446 2:26739122-26739144 CTGTGCTCCTGTGACAGTGAGGG - Intergenic
928082235 2:28321659-28321681 ATGTGCTCTTGGCAGAGGGAGGG + Intronic
928385524 2:30864544-30864566 CTCAGCTCCCAGGAGAGGAATGG + Intergenic
929453451 2:42051079-42051101 CTGGGCTGCTCAGAGAGGGAGGG - Intronic
929668889 2:43853871-43853893 CTGTCCTCCTGGGGGAAGGATGG - Intronic
930031932 2:47063736-47063758 CTGTGCCCTCAGGGGAGGGAAGG - Intronic
931544094 2:63361805-63361827 CTGTGCTTCTCAGAGCGGGAGGG + Intronic
932572653 2:72946083-72946105 CTGTCCTGCGAGGGGAGGGATGG - Intronic
935147946 2:100409004-100409026 CACTGATCCTAGGAGAGGGTGGG - Intronic
935843086 2:107134693-107134715 CTGTGACCCTAAGTGAGGGATGG + Intergenic
936462951 2:112725282-112725304 CTGGGCTCCTAGTCGAGGGAAGG - Intronic
936831445 2:116653110-116653132 CTGAACTCCTGGGAGAGGGAGGG + Intergenic
937360999 2:121230126-121230148 CTGTGCTGGTGGGAGCGGGATGG - Intronic
938247108 2:129786284-129786306 CTGGGCGCCTAGGAAATGGAGGG - Intergenic
940606617 2:155932117-155932139 CTGGGTTGCTAGGAGTGGGATGG - Intergenic
940755213 2:157674194-157674216 CTTTTCTCCCAAGAGAGGGAAGG - Intergenic
940913494 2:159229481-159229503 CTGTGCTCAAAGGAAAGAGAAGG - Intronic
942043980 2:172088376-172088398 CGGGGCTCCGAGGAGATGGAGGG - Exonic
945039272 2:205730572-205730594 CTCTGCTCAGAGCAGAGGGAAGG + Intronic
947498765 2:230657447-230657469 CTGTGGTACCAGGAGAGGGTTGG - Intergenic
947731324 2:232433136-232433158 CTGTGATCCTGGCAGAGGGGAGG + Intergenic
948114840 2:235487148-235487170 TTGGGCTCCTAGGTGAGGGTCGG - Intergenic
948730789 2:239962547-239962569 CTGTGCACCTAGGAGAGGAGAGG - Intronic
948847488 2:240690146-240690168 CTCTGCTCCTCTGAGAGGGCAGG + Intergenic
948907925 2:240988660-240988682 CTGTGCTCCCAGAGGAGGGCTGG + Intronic
1169338964 20:4781574-4781596 CTGTGATCACATGAGAGGGAAGG - Exonic
1169975618 20:11323944-11323966 CTGTGCTCCTTGGAGAATTAGGG - Intergenic
1170422199 20:16204229-16204251 ATGGGCTCCTAGGAGGGGGTGGG + Intergenic
1171216821 20:23358228-23358250 CAGGGCTCCTTGGAGACGGAGGG - Intergenic
1171404408 20:24900249-24900271 CTGGGCTCCTACCAGTGGGATGG + Intergenic
1171408964 20:24933485-24933507 CTGGGCTCCCAGGAGAGGCTGGG - Intergenic
1172097263 20:32466552-32466574 CTCTGCTCCTGGGGGAGGGGAGG + Intronic
1172143826 20:32742979-32743001 TTGGGGTCCTAGAAGAGGGACGG - Intronic
1172442373 20:34975138-34975160 CTATTATCCTAGGTGAGGGATGG + Intergenic
1173371244 20:42438222-42438244 CAGTTGTCCTAGGAGAGAGAAGG - Intronic
1174123840 20:48288191-48288213 CTGTGCTGCTGAGAGAGAGAGGG - Intergenic
1175479230 20:59300047-59300069 CTGAACTCCTGGGAGAGGTAGGG + Intergenic
1178999682 21:37445096-37445118 CTGTGCTCCTAGGCACAGGATGG + Intronic
1179029844 21:37711221-37711243 CTGAGCTCCCAGCAGACGGAAGG + Intronic
1179275140 21:39885385-39885407 CTGTGGTCAGAGCAGAGGGAGGG - Intronic
1179455594 21:41497685-41497707 GTGGGCTCCAGGGAGAGGGAAGG + Intronic
1179646193 21:42777773-42777795 CTGTGCTCCTCTGAGAGGACAGG + Intergenic
1179819400 21:43927994-43928016 CCCAGCTCCTTGGAGAGGGAGGG - Intronic
1180001811 21:44998528-44998550 CTGTTCTCCCCGGAGAGGCAGGG - Intergenic
1180124738 21:45782816-45782838 CTGGGCTCCTTGGAGAGCAATGG - Intronic
1180447767 22:15431294-15431316 CTGGAATCCTAAGAGAGGGACGG - Intergenic
1181949939 22:26546537-26546559 CTGTGTTCCCTGGAGGGGGATGG - Intronic
1182302123 22:29342822-29342844 CTGTGCTTCTACCAGAGGGTTGG + Intronic
1183013776 22:34969405-34969427 CTGTGCTTCATGGAGATGGACGG - Intergenic
1183065851 22:35362183-35362205 CTGTGCTCCTCAGAGAGGCCTGG - Intergenic
1184186670 22:42869451-42869473 ATGTGCTCATAGGAGAGTTATGG + Intronic
1184347006 22:43919796-43919818 CATTGCTCCTAGGGGACGGATGG + Intergenic
1185238185 22:49726628-49726650 CCCAGCTCCTAGGGGAGGGAGGG + Intergenic
949198253 3:1339286-1339308 CTATGCTCCTTGGAGAGCTAGGG - Intronic
949681035 3:6514710-6514732 CTTTTCTCCTGGTAGAGGGAGGG - Intergenic
950898320 3:16473825-16473847 TCGTGCTTCTAGGACAGGGAAGG - Intronic
951671569 3:25189440-25189462 CCCTGCTCCTAGGGGAGGGTTGG - Intronic
952211165 3:31230924-31230946 CTGAACTCCTGGGAGAGGGCAGG + Intergenic
952997618 3:38900265-38900287 CTGGGCACCATGGAGAGGGATGG - Intronic
953036880 3:39219844-39219866 CTTTGCTCTTGAGAGAGGGAGGG - Intergenic
954212039 3:49103399-49103421 CTATGCTTCTAGGAGAGGCTCGG - Exonic
954270355 3:49503128-49503150 CTGTGTGCCTAGGAGTGGAAGGG + Intronic
954360175 3:50117919-50117941 CTGTGCTCCCAGGACAGAGCAGG - Intronic
954596490 3:51829825-51829847 CAGTTCACCAAGGAGAGGGAGGG - Intronic
954650992 3:52162587-52162609 CTGTGCTCTTGGGGGAGGGCTGG - Intergenic
955193646 3:56785015-56785037 CTGTTGTCCTGGGAGAGGCATGG + Intronic
956649857 3:71494570-71494592 CTATGCTCATTGGAGAGGAATGG - Intronic
956738722 3:72258740-72258762 CTGGGCTCCTTGGGGAGGGGTGG - Intergenic
957041858 3:75341811-75341833 CTGAGCTCCCAGGGGAGGGAGGG - Intergenic
960199368 3:114812749-114812771 CGGTGCTCCTAGGGGAGGCTCGG + Intronic
960664049 3:120093697-120093719 CTCTCCTCCCAGGAAAGGGAGGG - Intronic
961739435 3:129023803-129023825 CTGTGCACCTCAGAGAGGGGTGG - Intronic
962068515 3:132009298-132009320 CTCTGCTCCTGGGGGAGGGGAGG + Intronic
963601172 3:147380255-147380277 CTGGGCTTCTGGGAGAAGGATGG - Intergenic
963972765 3:151447727-151447749 CAATTCTCCTAGCAGAGGGAGGG + Exonic
965250732 3:166341537-166341559 CTGTGCTCTGGGGAGAGTGAGGG + Intergenic
965617769 3:170612475-170612497 CTGTGCTGCAAGGACAGGGTCGG - Intronic
967314053 3:188134068-188134090 CTGTGCTCCACAGACAGGGAAGG - Intergenic
968007471 3:195253156-195253178 CTGGGCCCCGGGGAGAGGGAGGG - Intronic
968137988 3:196232771-196232793 CTCAGCTCCTGGGAGAGGAATGG + Intronic
968594095 4:1473471-1473493 CTGTGCTCCTGGGTCAGGGCTGG - Intergenic
969489666 4:7491871-7491893 CTGTGCTCCCAGCTGTGGGAAGG + Intronic
970312036 4:14792952-14792974 TGGTGCTCATAGGAGAGGCATGG + Intergenic
970664142 4:18318108-18318130 CTCAGCTCCTAGCACAGGGAAGG - Intergenic
971478579 4:27094428-27094450 CCGTGCTCCTGAGAGAGGGTGGG + Intergenic
972424467 4:38919470-38919492 CTGTGCTCCTGACAGTGGGATGG - Intronic
972618391 4:40722451-40722473 CTGTGCTCCTGGAACAGTGAAGG + Intergenic
974146081 4:57949067-57949089 CTGTCCTCAAGGGAGAGGGAAGG - Intergenic
974854113 4:67438899-67438921 CTGTGCTTCTTGCAGAGGGAGGG + Intergenic
975376021 4:73646451-73646473 CTATGCACTTGGGAGAGGGATGG - Intergenic
976795815 4:88931174-88931196 CATTGCTCCAAGGAGAGAGAGGG - Intronic
981292989 4:143098000-143098022 ATGTGCTCCAGGAAGAGGGAAGG - Intergenic
981821191 4:148889356-148889378 CTGGGCTCTCAGGAGAGGCAGGG + Intergenic
982070483 4:151689929-151689951 CTGTGCTGCTCAGAAAGGGAAGG + Intronic
983774939 4:171594935-171594957 CTGTCCTCCCAAGGGAGGGATGG - Intergenic
985983407 5:3490441-3490463 CCGTGCAGCAAGGAGAGGGAAGG + Intergenic
987869214 5:23591418-23591440 CTGAGAACCTGGGAGAGGGAGGG + Intergenic
992161561 5:74008865-74008887 CTGTGCTTCAAGGGGAGGAAGGG + Intergenic
996464697 5:123786153-123786175 CGGTGCTCCTGGGAGGGTGAAGG - Intergenic
996675734 5:126172420-126172442 CTGAGCCCCTAGGGGAGGGCTGG + Intergenic
997737999 5:136228603-136228625 CTGTGCTGCTTGCAGAGGCAGGG + Intronic
998006358 5:138659574-138659596 CAGTGGTCCTGGGAGTGGGAAGG + Intronic
999370528 5:151052392-151052414 CTTAGCTCCTTAGAGAGGGATGG - Intronic
999404906 5:151298319-151298341 ATGTGATCCTAGGAGTGGGGAGG + Intronic
999495693 5:152094606-152094628 CTTTGCTATTAGGTGAGGGAAGG - Intergenic
999815005 5:155167329-155167351 CTGTGATCTCAGAAGAGGGAAGG + Intergenic
1002057393 5:176606299-176606321 CTGTGCTCCCAGGAGGGGGCAGG + Intronic
1002693788 5:181070623-181070645 CTGTGCTCTTGGGGGAGGGCTGG - Intergenic
1003642478 6:7887494-7887516 CTGTGCAGCGCGGAGAGGGAGGG - Intronic
1003773183 6:9330760-9330782 TAGTGCTACTAGGACAGGGATGG - Intergenic
1004696939 6:18042750-18042772 CTGTGCTCTTGGGGGAGGGCTGG + Intergenic
1004910656 6:20279732-20279754 CGGAGCTGCTAGGGGAGGGAAGG - Intergenic
1005128882 6:22480096-22480118 TAGTGCTTCTAGCAGAGGGAGGG + Intergenic
1006131464 6:31871638-31871660 CAGTGCCCTTAGGGGAGGGAAGG + Intronic
1008851915 6:56032739-56032761 TTGTGCTTCCAGCAGAGGGAGGG - Intergenic
1009301403 6:62027611-62027633 CTAACCTCCTAGGAGTGGGAGGG + Intronic
1010116237 6:72316252-72316274 CTGTGCTCCAAGCTGGGGGAGGG - Intronic
1011572994 6:88760364-88760386 CAGTGTGCCTAGGAGAGGCAAGG - Intronic
1012430494 6:99159074-99159096 CTGTGCTCCTTGGAGTGTGAGGG + Intergenic
1012807387 6:103911658-103911680 CTTTCCTTCTAGTAGAGGGAGGG + Intergenic
1014680488 6:124423708-124423730 CTGTGCTCCTACAAGGTGGAAGG - Intronic
1018647937 6:165965215-165965237 AGGTGCCCCGAGGAGAGGGATGG + Intronic
1019443894 7:1061037-1061059 CTGAGCTCCCAGGAAAGGGGCGG + Intronic
1023132419 7:37015885-37015907 CTGTGTTACTAGCAGAGAGATGG + Intronic
1023200899 7:37695363-37695385 CTGTGCTCTTAGCAGAGGAGTGG - Intronic
1023854761 7:44175988-44176010 GCGTGCTCCTAGGGGTGGGATGG + Intronic
1023986673 7:45101121-45101143 CTGGGCTCCTGGGAGAGGCCCGG + Intronic
1024005548 7:45222801-45222823 CTGTGTTCTCAGGAGAGGAAGGG - Intergenic
1027340259 7:77199875-77199897 CTGTGTTCCCAGGAAAGGGTGGG + Intronic
1028567093 7:92245804-92245826 CTGAGGTGCGAGGAGAGGGAAGG - Intronic
1029203628 7:98855423-98855445 GCCTGCTCTTAGGAGAGGGACGG - Intronic
1029361100 7:100089127-100089149 CTGTGCTCCCGGGAGAAGGGAGG + Intronic
1029368392 7:100131195-100131217 CTGCGCTCCCGGGAGAGGGACGG - Intergenic
1030040047 7:105441364-105441386 CTGTGATTCTAGGACAGGCATGG - Intronic
1030219285 7:107080151-107080173 CTGTGCTCCTCCGAGAGCCACGG - Intronic
1032464358 7:132134569-132134591 CTGTGCTCCCTGGCAAGGGAAGG + Intronic
1034997993 7:155590545-155590567 CTGGGCTCATTGGAGAGGTACGG + Intergenic
1034998212 7:155591675-155591697 CTGGGCTCATTGGAGAGGTACGG - Intergenic
1035277955 7:157759157-157759179 CGATGCTCCCAGGAGAGGGAAGG - Intronic
1035491730 7:159285029-159285051 CTGAGCCCCTAGGGGAGGGGTGG + Intergenic
1037832437 8:22197447-22197469 CTGTTCTCCGAGGAGAGGTGGGG - Intronic
1039252571 8:35682843-35682865 CTGTGCTCAGAGGATGGGGAAGG + Intronic
1039378936 8:37066943-37066965 CTGTGCTCCTAAGGGAGGAATGG - Intergenic
1039471672 8:37817193-37817215 CTGGGTTCCTGGGAGTGGGAAGG + Intronic
1040572985 8:48625767-48625789 CCCTGCTCCGAGGGGAGGGAGGG - Intergenic
1041989704 8:63971927-63971949 CTGCTGTTCTAGGAGAGGGAGGG - Intergenic
1043226917 8:77745186-77745208 CTGTGGGCTTAGGAGAGGGAGGG + Intergenic
1043578375 8:81683703-81683725 CTGAGCTCACAGGAGAGGTATGG + Intronic
1046093570 8:109531845-109531867 CTCTGTTCCTGGGATAGGGAGGG + Intergenic
1046103991 8:109645013-109645035 CCGAGCTCCTTGGAGAGGGAGGG - Intronic
1047869731 8:129069699-129069721 CTGGGATATTAGGAGAGGGAGGG - Intergenic
1048420488 8:134273661-134273683 CTGTTCTACCTGGAGAGGGAGGG + Intergenic
1048542171 8:135352554-135352576 CTGTGCACCTTGGAGAAGGAGGG + Intergenic
1049037440 8:140087398-140087420 CTGTGCTCCAGGGAGAGGTCTGG - Intronic
1049752914 8:144294039-144294061 CTGTTCTCCCTGGGGAGGGATGG + Intronic
1049986357 9:955202-955224 CAGTGCTCCTGAGAGAGGGCAGG + Intronic
1050319103 9:4432903-4432925 CTGTGATCCCAGCACAGGGAGGG - Intergenic
1050536455 9:6634837-6634859 CTGAGATCAGAGGAGAGGGAGGG - Intronic
1053604726 9:39645573-39645595 GTGTGCACATATGAGAGGGAAGG - Intergenic
1053862541 9:42401584-42401606 GTGTGCACATATGAGAGGGAAGG - Intergenic
1054248816 9:62696843-62696865 GTGTGCACATATGAGAGGGAAGG + Intergenic
1054562927 9:66731369-66731391 GTGTGCACATATGAGAGGGAAGG + Intergenic
1055647035 9:78371026-78371048 CTGTGCTCTGTGGACAGGGAGGG + Intergenic
1056192120 9:84194788-84194810 CTGTGCTCTTGGGGGAGGGCTGG - Intergenic
1056690832 9:88807522-88807544 CTGTGCTCCTGGGAGCAGGCCGG + Intergenic
1057878196 9:98773628-98773650 CTGTGCTCCTTGGAGATCTAGGG + Intronic
1057910758 9:99018392-99018414 CTGTGCTCATGGGAGTGTGAGGG + Intronic
1058365712 9:104206144-104206166 TTGTGCTTCCAGCAGAGGGAGGG + Intergenic
1060668978 9:125451693-125451715 CTGTGGTCCCAGGATAGAGAGGG - Intronic
1061385476 9:130286961-130286983 CTGTGCTCCTGGGAGCGGACGGG - Intronic
1061533770 9:131235040-131235062 CTGTGCAGTTAGGAGAGGGAGGG + Intergenic
1061763082 9:132863856-132863878 CTTTTCCCATAGGAGAGGGAAGG - Intronic
1061797702 9:133098033-133098055 CTCTGCTCCCAGGGGAGGGCTGG + Exonic
1061931598 9:133835755-133835777 CTGTGCTCCTGCGGGAGGGCAGG + Intronic
1062627100 9:137448298-137448320 CTGTGTTCCCAGCTGAGGGAGGG - Exonic
1062710145 9:137971098-137971120 CTGTGCTCCTAGAAGGTGGCTGG + Intronic
1062712499 9:137984260-137984282 CTGCGCTCCCAGGCGAGGGCAGG + Intronic
1062718288 9:138022202-138022224 CTCTGCTCCCAGTAGAGGGAGGG + Intronic
1189405514 X:40719290-40719312 CTGTATACCTAGGAGTGGGATGG - Intronic
1191225222 X:58035304-58035326 CTGAGCTCCCAGAAGAGGGGTGG - Intergenic
1191826817 X:65375107-65375129 CTGTGTTCTTGGGAAAGGGAGGG + Intronic
1195128903 X:101836076-101836098 CTGTGCTCCTAGGAGAGGGAGGG + Intronic
1195177376 X:102323773-102323795 TGCTGCTCCTGGGAGAGGGAGGG - Exonic
1195181488 X:102363320-102363342 TGCTGCTCCTGGGAGAGGGAGGG + Exonic
1196146279 X:112320902-112320924 CTTTGCTCCTAAAAGAGGGAGGG + Intergenic
1197748033 X:129946117-129946139 CTGGGGTTCTAGGAGAGGCATGG - Intergenic
1197883215 X:131191095-131191117 CTGTGTTCCGATGAGAGGGCAGG + Intergenic
1197951999 X:131908016-131908038 CTGTGCTATTTGGAGAGGGCTGG + Intergenic
1197977101 X:132177468-132177490 CAGGGGTCCTGGGAGAGGGAAGG + Intergenic
1198311301 X:135427203-135427225 CAGTGCCCCTTGGAGAGGCAGGG + Intergenic
1198749101 X:139921037-139921059 TTGAGCTACTAGGAGGGGGATGG + Intronic
1200101768 X:153691960-153691982 CTTTGTTCCTAGGGGAGGGAGGG - Exonic
1201696539 Y:16832999-16833021 CTGTGAGCCTAGGAGAAGGGGGG - Intergenic