ID: 1195137342

View in Genome Browser
Species Human (GRCh38)
Location X:101922367-101922389
Sequence GCCTTTCTAAGAGTGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195137342_1195137345 6 Left 1195137342 X:101922367-101922389 CCTGAGCTCACTCTTAGAAAGGC No data
Right 1195137345 X:101922396-101922418 TTTTTTTTTTTTTCCTGAGATGG No data
1195137342_1195137347 27 Left 1195137342 X:101922367-101922389 CCTGAGCTCACTCTTAGAAAGGC No data
Right 1195137347 X:101922417-101922439 GGAATCTTGCTATGTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195137342 Original CRISPR GCCTTTCTAAGAGTGAGCTC AGG (reversed) Intronic