ID: 1195137342

View in Genome Browser
Species Human (GRCh38)
Location X:101922367-101922389
Sequence GCCTTTCTAAGAGTGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195137342_1195137345 6 Left 1195137342 X:101922367-101922389 CCTGAGCTCACTCTTAGAAAGGC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1195137345 X:101922396-101922418 TTTTTTTTTTTTTCCTGAGATGG 0: 549
1: 3535
2: 89530
3: 68515
4: 108937
1195137342_1195137347 27 Left 1195137342 X:101922367-101922389 CCTGAGCTCACTCTTAGAAAGGC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1195137347 X:101922417-101922439 GGAATCTTGCTATGTCATCCAGG 0: 1
1: 50
2: 1607
3: 18353
4: 61399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195137342 Original CRISPR GCCTTTCTAAGAGTGAGCTC AGG (reversed) Intronic
901144614 1:7056690-7056712 TCCTTTCCAAGGGTGGGCTCTGG - Intronic
902425555 1:16318797-16318819 GCCTGTCCAACAGAGAGCTCGGG + Intronic
909356454 1:74715403-74715425 GCCTTCCTGAGAGTCAGATCTGG - Intronic
909523658 1:76598143-76598165 GCCCTTCTAAAAGAGATCTCAGG - Intronic
917683392 1:177391436-177391458 GGTTTCCTAGGAGTGAGCTCTGG + Intergenic
917791832 1:178504060-178504082 GGATGTCTGAGAGTGAGCTCAGG + Intergenic
920043307 1:203117711-203117733 GCCTTTCTGCAGGTGAGCTCAGG + Intronic
1063895855 10:10680796-10680818 ACCTTGCTAAAAGAGAGCTCTGG - Intergenic
1064247235 10:13678727-13678749 TCCTTTCTAAAGGTGAGCTTTGG - Intronic
1068283288 10:54904817-54904839 GACCTTCTGAGAGTGAGCTGTGG - Intronic
1068416051 10:56724144-56724166 GCCTTTTAAAGAGGAAGCTCTGG - Intergenic
1070553215 10:77507695-77507717 CCCTTTTCAAGAGGGAGCTCAGG - Intronic
1071387365 10:85135120-85135142 GCCTTTCTTAGATCAAGCTCTGG + Intergenic
1075918466 10:126190018-126190040 CCATTTGGAAGAGTGAGCTCAGG - Intronic
1076719349 10:132386486-132386508 GCCTCTCACAGAGTGAGGTCGGG - Intergenic
1077808150 11:5610135-5610157 TCCTTTCTAGGAGTGAGTTCTGG + Exonic
1078661033 11:13285721-13285743 GCCTTCCTAACACTGGGCTCAGG - Intronic
1079246675 11:18757381-18757403 GCCCTTCAAAGTGTGAGATCAGG - Intronic
1080456840 11:32426812-32426834 GCCTTTACGAGAGTGAGCCCGGG - Intronic
1084550371 11:69837870-69837892 GCAATTCTCAGAGAGAGCTCTGG + Intergenic
1087082395 11:94184137-94184159 GCTTGTCCAAGAGTGAGCTCAGG + Intergenic
1087095812 11:94316752-94316774 TGCTTTCTAAGAGTGAGGTGAGG - Intergenic
1088607836 11:111548328-111548350 GCCTCTCTATCAGTGAGTTCTGG + Intronic
1090161657 11:124501705-124501727 GCCATACTAAGAGTGTGCACAGG + Intergenic
1091361297 11:134980501-134980523 GCGGTTCTAAGTGTGAGCACTGG - Intergenic
1091624027 12:2109048-2109070 CCCTTTCTAGGTGTGAGCTGCGG + Intronic
1095946298 12:47755763-47755785 GGCTTTCGAAGAGGGAGGTCTGG + Intronic
1098385508 12:69914678-69914700 GCCTTCCTAGGAATGAGCTTAGG - Intronic
1101122760 12:101600128-101600150 GCCTTTCAAACAGTGAAGTCAGG + Intronic
1103881860 12:124172447-124172469 GCCTTTATAAGAGGGAGGCCAGG - Intronic
1104322835 12:127768079-127768101 AACTTTCCAAGAGTGAGCTGAGG - Intergenic
1105935180 13:25091796-25091818 GGCTTTCCAAGATTGAGCTTAGG - Intergenic
1106136304 13:26976099-26976121 GCCTGTCTACCAGGGAGCTCAGG + Intergenic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1106568698 13:30907616-30907638 CCCTTGCCAAGAGTGAACTCTGG - Intronic
1108569381 13:51734128-51734150 GCCTTTCCCAGAGTGTGATCTGG - Intronic
1108969665 13:56357526-56357548 GCTGATCTAACAGTGAGCTCTGG - Intergenic
1109189738 13:59309910-59309932 GCCTGTCTGAGAGGGAGCTCAGG + Intergenic
1110136542 13:72074231-72074253 GGGTTTCTAAGAGTGACCTCTGG + Intergenic
1114261078 14:21036773-21036795 GGCTTTCTAAGTGGGACCTCTGG - Intronic
1119549323 14:75496957-75496979 CCCTCTGTAAGAGTGGGCTCTGG + Intergenic
1130227942 15:82073886-82073908 GCCTTGCTAAGTCTGAGCTCAGG - Intergenic
1134818382 16:17225422-17225444 GGCTTTCTGAGCATGAGCTCAGG + Intronic
1138620466 16:58206873-58206895 GCCTTTCCTACAGTGATCTCTGG + Intergenic
1140137749 16:72222815-72222837 GCCTGGCTTAGAGTAAGCTCTGG + Intergenic
1140883143 16:79217407-79217429 TCCTATTTAAGAATGAGCTCTGG + Intergenic
1141570574 16:84931185-84931207 CCCTTTCTAAGAGGGAGGTGAGG - Intergenic
1141936642 16:87243706-87243728 GCTTTACTAAGAGAGGGCTCAGG - Intronic
1143731185 17:8883821-8883843 GCCTTCCTAAGAGTGAACAAAGG - Intronic
1144632591 17:16881688-16881710 GCCATTCTAGGAGTGACCTGAGG - Intergenic
1147465646 17:40608712-40608734 AGCTTCCTAAGAGTGAGGTCTGG - Intergenic
1148228090 17:45913454-45913476 GCCATTAACAGAGTGAGCTCAGG + Intronic
1148959919 17:51384698-51384720 GCCTGTCTATGAAGGAGCTCTGG - Intergenic
1151447053 17:74173795-74173817 GAGTTTAGAAGAGTGAGCTCGGG - Intergenic
1151560606 17:74867645-74867667 GTCTTTCTAAGAGTGGGAGCAGG - Intronic
1151655106 17:75492155-75492177 ACATCTCTAAGAGGGAGCTCCGG - Intronic
1152386835 17:79979855-79979877 GCCTTGCTATGGGTGGGCTCTGG + Intronic
1153106068 18:1528432-1528454 GCATTTCTAGGAGAGAGCTCGGG + Intergenic
1155659368 18:28229463-28229485 GCCTTGATAAGTGTGAGCACTGG - Intergenic
1163740778 19:19010511-19010533 GCCCTGCTAAGAGTGACCACAGG + Intronic
1167940777 19:52944178-52944200 GCCTTTCAAAGAGAGACCCCAGG + Intronic
925085554 2:1105039-1105061 GCCTTTCTGAGGGTGAACTTGGG - Intronic
931919163 2:66994128-66994150 GCCTTTATAATCGTGAGCACTGG + Intergenic
940412046 2:153376384-153376406 GCCTTTCAAAGAAAGAGATCAGG + Intergenic
943847924 2:192675322-192675344 GCCCATTTCAGAGTGAGCTCGGG - Intergenic
946967461 2:225052957-225052979 CCCTTTCAAAAACTGAGCTCTGG - Intergenic
947982527 2:234422577-234422599 GCCTTTGCAGGAGTGAGCTCAGG - Intergenic
948443117 2:238010470-238010492 ACTTTTCAAATAGTGAGCTCTGG - Intronic
1181094196 22:20495032-20495054 GCCTTCCAAAGGGTGCGCTCTGG + Intronic
1184058571 22:42068181-42068203 GACCTTCTAAGAGTTATCTCAGG + Intronic
953528561 3:43716400-43716422 TCCTTTCTAAGACTGAGGTTTGG + Intronic
957125999 3:76161538-76161560 GCCCTGCTAAGAGTGCTCTCAGG + Intronic
960364052 3:116749188-116749210 GCCTCCCTAAGGGTGTGCTCAGG + Intronic
960519335 3:118637123-118637145 CCCTTTCTATCAGTGAGTTCAGG + Intergenic
962312838 3:134338180-134338202 GCCTTCCTAAGTGTGAGTCCTGG + Intergenic
962449852 3:135504012-135504034 ACCTTGCTATGAGAGAGCTCTGG + Intergenic
962471142 3:135710481-135710503 GACTTTCTATCAGTGAGCTTTGG + Intergenic
964442257 3:156724286-156724308 GTCTTTGTAAGATTGAGCTTAGG - Intergenic
969100572 4:4765211-4765233 GCCTTTCAAAAGGTGGGCTCCGG - Intergenic
969216767 4:5729399-5729421 GGCTTTCTATGATGGAGCTCAGG - Intronic
969262385 4:6042321-6042343 GGCTTCCTCAGAGTGTGCTCAGG + Intronic
972704643 4:41530354-41530376 TCCTTCCTAAGAATTAGCTCTGG + Intronic
975814700 4:78205702-78205724 TCCTTTCTGAGAGGGGGCTCTGG + Intronic
977424230 4:96846160-96846182 GCCTTTCTAAGAGAAAACACAGG - Intergenic
986285445 5:6355300-6355322 GCATTTAGAAGGGTGAGCTCTGG - Intergenic
987314777 5:16713881-16713903 GTCTTTGTTGGAGTGAGCTCAGG - Intronic
997234799 5:132266571-132266593 GCCTGGCTCAGAGTGAGCCCAGG + Intronic
1001050264 5:168408453-168408475 GCCTTCCCAGGAGGGAGCTCTGG - Intronic
1007248032 6:40476402-40476424 GCCTTTCTTACAGTGAGGTTGGG - Intronic
1009836702 6:69010244-69010266 TTCTTTCTAAGAATGTGCTCTGG - Intronic
1009938697 6:70263831-70263853 GCTTTTCTATGAGTGACATCAGG - Intronic
1013467546 6:110430648-110430670 GGCTTTCAAAGAGTGAGAGCAGG - Intronic
1015142044 6:129946234-129946256 GCCTTTCTGAGATTGATCTTTGG + Intergenic
1017359669 6:153552957-153552979 GCCATTCTAAGTGTGATCTGTGG - Intergenic
1029702219 7:102254645-102254667 GGCTTTCTAAATGTGAGCTTTGG - Exonic
1034992890 7:155559310-155559332 GCCCTTCTGAGAGTGGGCTCTGG - Intergenic
1035532581 8:364964-364986 GCCTCTCTAAGGGAGAGCTCAGG - Intergenic
1036175568 8:6534746-6534768 CCGTTTCTCAGAGTTAGCTCAGG + Intronic
1040005711 8:42619075-42619097 GCATTTCCAAGTGTGAGCCCAGG + Intergenic
1048299124 8:133238739-133238761 TATTTTGTAAGAGTGAGCTCTGG - Exonic
1049315271 8:141962868-141962890 GCATATCTAAGGGTGAGCTTGGG - Intergenic
1051878301 9:21813458-21813480 GGGTTGCTGAGAGTGAGCTCAGG + Intronic
1053364771 9:37514992-37515014 ATCTTTCTAAGTGAGAGCTCTGG - Intronic
1056637443 9:88342971-88342993 GCCTTGCTAAAAGAGACCTCTGG - Intergenic
1058683237 9:107458176-107458198 GCCTTTTTAAGCTTGGGCTCTGG + Intergenic
1058861059 9:109118558-109118580 GGTTTTGTAAGAGTAAGCTCAGG + Intronic
1060464517 9:123891067-123891089 GCCTTCAGAACAGTGAGCTCAGG + Intronic
1186895085 X:13997439-13997461 GCATCTATAAGAGTGAGCCCAGG + Intergenic
1191109490 X:56793732-56793754 GCCATCCTAAGAATGAGCCCAGG - Intergenic
1192165529 X:68825354-68825376 GCTTTTCTAACTGTTAGCTCTGG + Intergenic
1194573895 X:95587438-95587460 ACCTTTCCAAGCGTCAGCTCAGG - Intergenic
1195105302 X:101597676-101597698 GCCTCTCTAACAGTGGGGTCTGG - Intergenic
1195107580 X:101616091-101616113 GCCTCTCTAACAGTGGGGTCTGG + Exonic
1195137342 X:101922367-101922389 GCCTTTCTAAGAGTGAGCTCAGG - Intronic
1199574872 X:149304173-149304195 GCCTTTCCTAGACTGTGCTCAGG - Intergenic
1199875639 X:151925745-151925767 GCCTTTTTAATAGTCAGTTCTGG - Intergenic
1201786357 Y:17785863-17785885 GCCCATGTAAGAGTGAGATCCGG - Intergenic
1201815196 Y:18120125-18120147 GCCCATGTAAGAGTGAGATCCGG + Intergenic