ID: 1195137342 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:101922367-101922389 |
Sequence | GCCTTTCTAAGAGTGAGCTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1195137342_1195137347 | 27 | Left | 1195137342 | X:101922367-101922389 | CCTGAGCTCACTCTTAGAAAGGC | No data | ||
Right | 1195137347 | X:101922417-101922439 | GGAATCTTGCTATGTCATCCAGG | No data | ||||
1195137342_1195137345 | 6 | Left | 1195137342 | X:101922367-101922389 | CCTGAGCTCACTCTTAGAAAGGC | No data | ||
Right | 1195137345 | X:101922396-101922418 | TTTTTTTTTTTTTCCTGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1195137342 | Original CRISPR | GCCTTTCTAAGAGTGAGCTC AGG (reversed) | Intronic | ||