ID: 1195137345

View in Genome Browser
Species Human (GRCh38)
Location X:101922396-101922418
Sequence TTTTTTTTTTTTTCCTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195137342_1195137345 6 Left 1195137342 X:101922367-101922389 CCTGAGCTCACTCTTAGAAAGGC No data
Right 1195137345 X:101922396-101922418 TTTTTTTTTTTTTCCTGAGATGG No data
1195137338_1195137345 17 Left 1195137338 X:101922356-101922378 CCCAAGATTTCCCTGAGCTCACT No data
Right 1195137345 X:101922396-101922418 TTTTTTTTTTTTTCCTGAGATGG No data
1195137339_1195137345 16 Left 1195137339 X:101922357-101922379 CCAAGATTTCCCTGAGCTCACTC No data
Right 1195137345 X:101922396-101922418 TTTTTTTTTTTTTCCTGAGATGG No data
1195137340_1195137345 7 Left 1195137340 X:101922366-101922388 CCCTGAGCTCACTCTTAGAAAGG No data
Right 1195137345 X:101922396-101922418 TTTTTTTTTTTTTCCTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195137345 Original CRISPR TTTTTTTTTTTTTCCTGAGA TGG Intronic