ID: 1195138135

View in Genome Browser
Species Human (GRCh38)
Location X:101931635-101931657
Sequence GCGCCCAGCCCAATCTCGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195138123_1195138135 21 Left 1195138123 X:101931591-101931613 CCTTTACTGCGCCACGGCAGGTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1195138135 X:101931635-101931657 GCGCCCAGCCCAATCTCGGACGG 0: 1
1: 0
2: 1
3: 3
4: 44
1195138131_1195138135 10 Left 1195138131 X:101931602-101931624 CCACGGCAGGTGGGGGTGGGGCA 0: 1
1: 0
2: 7
3: 58
4: 427
Right 1195138135 X:101931635-101931657 GCGCCCAGCCCAATCTCGGACGG 0: 1
1: 0
2: 1
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195138135 Original CRISPR GCGCCCAGCCCAATCTCGGA CGG Intronic
903305341 1:22409007-22409029 GCCCCCAGCCCCAGCTGGGATGG + Intergenic
904143284 1:28370074-28370096 GGGCCCAGCCAAGTCTCGGGGGG - Intronic
905174065 1:36125314-36125336 GCGCCCAGCGCGGACTCGGACGG + Intergenic
907304530 1:53506424-53506446 GCGCCCAGCTCAAGCTCGGATGG + Exonic
907438310 1:54463422-54463444 GCTCCCATCCCAATCTCGACAGG + Intergenic
1063701986 10:8393914-8393936 GCGACCACTCCAATCTCTGATGG - Intergenic
1075751040 10:124771389-124771411 GCGCCCAGCCCATTTCCAGAAGG + Intronic
1077267424 11:1658537-1658559 GCGCCCAGCCTAACATGGGACGG - Intergenic
1084567805 11:69941701-69941723 GAGCCCAGCCCAGTCTCGGGCGG - Intergenic
1090859738 11:130642269-130642291 GTTCCCAGCCCCCTCTCGGAGGG + Intergenic
1096182951 12:49560498-49560520 GAGCCCAGCCTAATCTGGTATGG - Intronic
1105678950 13:22705972-22705994 GTGCCAAGCCAAATCTGGGAAGG - Intergenic
1119148552 14:72337610-72337632 GGGCCCAGCCCCATTTAGGAGGG - Intronic
1122337235 14:101001753-101001775 GCTCCCAGACCATTCTCAGATGG - Intergenic
1122599700 14:102915145-102915167 GGGCCCAGCTCCATCTCGGGCGG + Intergenic
1123947119 15:25244213-25244235 GCTCCCAGCTGAAACTCGGAAGG + Intergenic
1126072244 15:44875285-44875307 GCCCGAAGCCCTATCTCGGAGGG - Intergenic
1126497812 15:49311945-49311967 GCCCCCGGCCCAATCTCTCAGGG - Intronic
1137613808 16:49835519-49835541 GCCCCCAGCCCTGTCTCTGAGGG - Intronic
1139748940 16:69096907-69096929 GCGCCCAGCCTAATCTGAGGTGG + Intergenic
1144051261 17:11499039-11499061 CAGCCCAGCCCAATCTCTGAAGG - Intronic
1147499792 17:40951744-40951766 GTGTCCAGCCCAATCCAGGAAGG - Intergenic
1167705750 19:51079905-51079927 GAGCCCAGCCCAAGAGCGGAAGG - Intronic
938469485 2:131545350-131545372 GGGCCCAGCCCAACCTGGGGTGG + Intergenic
947641253 2:231708956-231708978 GCGCCCGGCCCACTCCCCGACGG - Intronic
1172760542 20:37318231-37318253 GCACCCAGCTCAATCTCGAGGGG + Intergenic
1176030603 20:63009430-63009452 GCGTCCAACCCCAGCTCGGAGGG - Intergenic
1182468361 22:30532049-30532071 AGGCCCAGCCCCATCTTGGATGG - Intronic
1183417890 22:37692937-37692959 GCGCTCAGCACAATCCCTGAGGG - Exonic
950336120 3:12194798-12194820 GCACCCAGCCCAGTCCCGGCAGG - Intergenic
976874493 4:89837040-89837062 GCGCCCAGGACGCTCTCGGAGGG + Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
996746755 5:126852759-126852781 GCGCCCAGCCTGATTTTGGAGGG + Intergenic
1000151195 5:158502832-158502854 GCGCCGAGGCCAATCTTTGATGG + Intergenic
1000336583 5:160245836-160245858 GCTCCCAGCCCCATCTGTGAAGG - Intergenic
1001652592 5:173326771-173326793 GCCCCCAGTCCTCTCTCGGAAGG + Intronic
1014132005 6:117845869-117845891 GTGCCCAGCCCCATCTGGCAAGG - Intergenic
1014702060 6:124701923-124701945 ATGCCCAGCCCAACCTGGGATGG - Intronic
1023945185 7:44797134-44797156 GCGCCCAGGCCAAGCTAGGGCGG - Intronic
1026460256 7:70608395-70608417 GCATCCAGCCCAATCTTTGACGG + Intronic
1033683609 7:143620299-143620321 GAGCCCACCCCAAGATCGGAGGG + Intergenic
1033701003 7:143837339-143837361 GAGCCCACCCCAAGATCGGAGGG - Intergenic
1038482275 8:27909875-27909897 ACCCCCAGCCCAGTCTCGGGGGG + Intronic
1043861948 8:85328586-85328608 CCGCCCAACCCAACCTCTGAAGG - Exonic
1056712436 9:89001706-89001728 GCGCCCTGCCCATTCTGGGCTGG + Exonic
1060952290 9:127612091-127612113 GCGCCCAGCCGCATCTCGGGGGG + Intergenic
1062689092 9:137832300-137832322 GAGCCCAGCCAATTCTAGGACGG - Intronic
1062689110 9:137832366-137832388 GAGCCCAGCCAATTCTAGGACGG - Intronic
1195138135 X:101931635-101931657 GCGCCCAGCCCAATCTCGGACGG + Intronic