ID: 1195139690

View in Genome Browser
Species Human (GRCh38)
Location X:101946968-101946990
Sequence CAGAGCCAATATTATTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195139689_1195139690 10 Left 1195139689 X:101946935-101946957 CCAATGAAGAATAAAAGATCTGA No data
Right 1195139690 X:101946968-101946990 CAGAGCCAATATTATTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195139690 Original CRISPR CAGAGCCAATATTATTAAGT AGG Intergenic
No off target data available for this crispr