ID: 1195140021

View in Genome Browser
Species Human (GRCh38)
Location X:101950016-101950038
Sequence GAGGGCAAGCAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2999
Summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195140009_1195140021 24 Left 1195140009 X:101949969-101949991 CCCTGTTCATCTCATTGGGACTG 0: 26
1: 538
2: 1084
3: 847
4: 948
Right 1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG 0: 67
1: 274
2: 555
3: 796
4: 1307
1195140010_1195140021 23 Left 1195140010 X:101949970-101949992 CCTGTTCATCTCATTGGGACTGG 0: 152
1: 412
2: 383
3: 237
4: 225
Right 1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG 0: 67
1: 274
2: 555
3: 796
4: 1307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195140021 Original CRISPR GAGGGCAAGCAGAAGCAGGG TGG Intergenic
Too many off-targets to display for this crispr