ID: 1195144604

View in Genome Browser
Species Human (GRCh38)
Location X:102000471-102000493
Sequence TATCCAGGACCACCCATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195144602_1195144604 -8 Left 1195144602 X:102000456-102000478 CCTGATGAAGTGGTTTATCCAGG No data
Right 1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG No data
1195144597_1195144604 6 Left 1195144597 X:102000442-102000464 CCCACTGTGACCACCCTGATGAA No data
Right 1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG No data
1195144601_1195144604 -7 Left 1195144601 X:102000455-102000477 CCCTGATGAAGTGGTTTATCCAG No data
Right 1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG No data
1195144600_1195144604 -4 Left 1195144600 X:102000452-102000474 CCACCCTGATGAAGTGGTTTATC No data
Right 1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG No data
1195144596_1195144604 7 Left 1195144596 X:102000441-102000463 CCCCACTGTGACCACCCTGATGA No data
Right 1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG No data
1195144598_1195144604 5 Left 1195144598 X:102000443-102000465 CCACTGTGACCACCCTGATGAAG No data
Right 1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195144604 Original CRISPR TATCCAGGACCACCCATCAG AGG Intergenic
No off target data available for this crispr