ID: 1195146909

View in Genome Browser
Species Human (GRCh38)
Location X:102027125-102027147
Sequence TGGGATCCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195146909_1195146912 -7 Left 1195146909 X:102027125-102027147 CCATCCACCACTGCTGGATCCCA No data
Right 1195146912 X:102027141-102027163 GATCCCATGTGCATCTTCTGAGG No data
1195146909_1195146916 1 Left 1195146909 X:102027125-102027147 CCATCCACCACTGCTGGATCCCA No data
Right 1195146916 X:102027149-102027171 GTGCATCTTCTGAGGGTCTGAGG No data
1195146909_1195146913 -6 Left 1195146909 X:102027125-102027147 CCATCCACCACTGCTGGATCCCA No data
Right 1195146913 X:102027142-102027164 ATCCCATGTGCATCTTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195146909 Original CRISPR TGGGATCCAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr