ID: 1195148637

View in Genome Browser
Species Human (GRCh38)
Location X:102043569-102043591
Sequence TGGGCAGGACCACCCAACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195148627_1195148637 22 Left 1195148627 X:102043524-102043546 CCAGACTGCTGTTTCAAGTGGGT No data
Right 1195148637 X:102043569-102043591 TGGGCAGGACCACCCAACCGGGG No data
1195148630_1195148637 -2 Left 1195148630 X:102043548-102043570 CCAGGTCTCATTCTTCCTCACTG No data
Right 1195148637 X:102043569-102043591 TGGGCAGGACCACCCAACCGGGG No data
1195148629_1195148637 -1 Left 1195148629 X:102043547-102043569 CCCAGGTCTCATTCTTCCTCACT No data
Right 1195148637 X:102043569-102043591 TGGGCAGGACCACCCAACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195148637 Original CRISPR TGGGCAGGACCACCCAACCG GGG Intergenic
No off target data available for this crispr