ID: 1195148695

View in Genome Browser
Species Human (GRCh38)
Location X:102043864-102043886
Sequence TTAATAGCTCTGGTGGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195148695_1195148710 29 Left 1195148695 X:102043864-102043886 CCACCCCCCACCAGAGCTATTAA No data
Right 1195148710 X:102043916-102043938 ACAGCTCCCACTGGGAGGGCTGG No data
1195148695_1195148709 25 Left 1195148695 X:102043864-102043886 CCACCCCCCACCAGAGCTATTAA No data
Right 1195148709 X:102043912-102043934 GGACACAGCTCCCACTGGGAGGG No data
1195148695_1195148711 30 Left 1195148695 X:102043864-102043886 CCACCCCCCACCAGAGCTATTAA No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data
1195148695_1195148708 24 Left 1195148695 X:102043864-102043886 CCACCCCCCACCAGAGCTATTAA No data
Right 1195148708 X:102043911-102043933 TGGACACAGCTCCCACTGGGAGG No data
1195148695_1195148706 21 Left 1195148695 X:102043864-102043886 CCACCCCCCACCAGAGCTATTAA No data
Right 1195148706 X:102043908-102043930 CCCTGGACACAGCTCCCACTGGG No data
1195148695_1195148704 20 Left 1195148695 X:102043864-102043886 CCACCCCCCACCAGAGCTATTAA No data
Right 1195148704 X:102043907-102043929 TCCCTGGACACAGCTCCCACTGG No data
1195148695_1195148703 4 Left 1195148695 X:102043864-102043886 CCACCCCCCACCAGAGCTATTAA No data
Right 1195148703 X:102043891-102043913 GTAGCAGCTCTGCAACTCCCTGG 0: 12
1: 30
2: 56
3: 132
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195148695 Original CRISPR TTAATAGCTCTGGTGGGGGG TGG (reversed) Intergenic
No off target data available for this crispr