ID: 1195148700

View in Genome Browser
Species Human (GRCh38)
Location X:102043871-102043893
Sequence TACTGGCTTAATAGCTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195148700_1195148710 22 Left 1195148700 X:102043871-102043893 CCACCAGAGCTATTAAGCCAGTA No data
Right 1195148710 X:102043916-102043938 ACAGCTCCCACTGGGAGGGCTGG No data
1195148700_1195148704 13 Left 1195148700 X:102043871-102043893 CCACCAGAGCTATTAAGCCAGTA No data
Right 1195148704 X:102043907-102043929 TCCCTGGACACAGCTCCCACTGG No data
1195148700_1195148706 14 Left 1195148700 X:102043871-102043893 CCACCAGAGCTATTAAGCCAGTA No data
Right 1195148706 X:102043908-102043930 CCCTGGACACAGCTCCCACTGGG No data
1195148700_1195148709 18 Left 1195148700 X:102043871-102043893 CCACCAGAGCTATTAAGCCAGTA No data
Right 1195148709 X:102043912-102043934 GGACACAGCTCCCACTGGGAGGG No data
1195148700_1195148703 -3 Left 1195148700 X:102043871-102043893 CCACCAGAGCTATTAAGCCAGTA No data
Right 1195148703 X:102043891-102043913 GTAGCAGCTCTGCAACTCCCTGG 0: 12
1: 30
2: 56
3: 132
4: 311
1195148700_1195148708 17 Left 1195148700 X:102043871-102043893 CCACCAGAGCTATTAAGCCAGTA No data
Right 1195148708 X:102043911-102043933 TGGACACAGCTCCCACTGGGAGG No data
1195148700_1195148711 23 Left 1195148700 X:102043871-102043893 CCACCAGAGCTATTAAGCCAGTA No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195148700 Original CRISPR TACTGGCTTAATAGCTCTGG TGG (reversed) Intergenic
No off target data available for this crispr