ID: 1195148702

View in Genome Browser
Species Human (GRCh38)
Location X:102043888-102043910
Sequence GGGAGTTGCAGAGCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195148702_1195148708 0 Left 1195148702 X:102043888-102043910 CCAGTAGCAGCTCTGCAACTCCC No data
Right 1195148708 X:102043911-102043933 TGGACACAGCTCCCACTGGGAGG No data
1195148702_1195148711 6 Left 1195148702 X:102043888-102043910 CCAGTAGCAGCTCTGCAACTCCC No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data
1195148702_1195148709 1 Left 1195148702 X:102043888-102043910 CCAGTAGCAGCTCTGCAACTCCC No data
Right 1195148709 X:102043912-102043934 GGACACAGCTCCCACTGGGAGGG No data
1195148702_1195148704 -4 Left 1195148702 X:102043888-102043910 CCAGTAGCAGCTCTGCAACTCCC No data
Right 1195148704 X:102043907-102043929 TCCCTGGACACAGCTCCCACTGG No data
1195148702_1195148706 -3 Left 1195148702 X:102043888-102043910 CCAGTAGCAGCTCTGCAACTCCC No data
Right 1195148706 X:102043908-102043930 CCCTGGACACAGCTCCCACTGGG No data
1195148702_1195148710 5 Left 1195148702 X:102043888-102043910 CCAGTAGCAGCTCTGCAACTCCC No data
Right 1195148710 X:102043916-102043938 ACAGCTCCCACTGGGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195148702 Original CRISPR GGGAGTTGCAGAGCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr