ID: 1195148711

View in Genome Browser
Species Human (GRCh38)
Location X:102043917-102043939
Sequence CAGCTCCCACTGGGAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195148701_1195148711 20 Left 1195148701 X:102043874-102043896 CCAGAGCTATTAAGCCAGTAGCA No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data
1195148700_1195148711 23 Left 1195148700 X:102043871-102043893 CCACCAGAGCTATTAAGCCAGTA No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data
1195148697_1195148711 26 Left 1195148697 X:102043868-102043890 CCCCCACCAGAGCTATTAAGCCA No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data
1195148702_1195148711 6 Left 1195148702 X:102043888-102043910 CCAGTAGCAGCTCTGCAACTCCC No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data
1195148695_1195148711 30 Left 1195148695 X:102043864-102043886 CCACCCCCCACCAGAGCTATTAA No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data
1195148699_1195148711 24 Left 1195148699 X:102043870-102043892 CCCACCAGAGCTATTAAGCCAGT No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data
1195148698_1195148711 25 Left 1195148698 X:102043869-102043891 CCCCACCAGAGCTATTAAGCCAG No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data
1195148696_1195148711 27 Left 1195148696 X:102043867-102043889 CCCCCCACCAGAGCTATTAAGCC No data
Right 1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195148711 Original CRISPR CAGCTCCCACTGGGAGGGCT GGG Intergenic
No off target data available for this crispr