ID: 1195155143

View in Genome Browser
Species Human (GRCh38)
Location X:102115609-102115631
Sequence CAGGAAAGCCCCAAATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195155135_1195155143 2 Left 1195155135 X:102115584-102115606 CCAGATGGTGCAGCCTCCTGTTT No data
Right 1195155143 X:102115609-102115631 CAGGAAAGCCCCAAATGGCAGGG No data
1195155133_1195155143 7 Left 1195155133 X:102115579-102115601 CCCAGCCAGATGGTGCAGCCTCC No data
Right 1195155143 X:102115609-102115631 CAGGAAAGCCCCAAATGGCAGGG No data
1195155134_1195155143 6 Left 1195155134 X:102115580-102115602 CCAGCCAGATGGTGCAGCCTCCT No data
Right 1195155143 X:102115609-102115631 CAGGAAAGCCCCAAATGGCAGGG No data
1195155132_1195155143 16 Left 1195155132 X:102115570-102115592 CCGTGTGAACCCAGCCAGATGGT No data
Right 1195155143 X:102115609-102115631 CAGGAAAGCCCCAAATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195155143 Original CRISPR CAGGAAAGCCCCAAATGGCA GGG Intergenic
No off target data available for this crispr