ID: 1195156990

View in Genome Browser
Species Human (GRCh38)
Location X:102133451-102133473
Sequence CTTGAATTTCAGTTGGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1195156987_1195156990 -10 Left 1195156987 X:102133438-102133460 CCTGGTATACGTCCTTGAATTTC No data
Right 1195156990 X:102133451-102133473 CTTGAATTTCAGTTGGTACCAGG No data
1195156986_1195156990 6 Left 1195156986 X:102133422-102133444 CCAAGGGAGGAAGGGTCCTGGTA No data
Right 1195156990 X:102133451-102133473 CTTGAATTTCAGTTGGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1195156990 Original CRISPR CTTGAATTTCAGTTGGTACC AGG Intergenic
No off target data available for this crispr