ID: 1195156990 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:102133451-102133473 |
Sequence | CTTGAATTTCAGTTGGTACC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1195156987_1195156990 | -10 | Left | 1195156987 | X:102133438-102133460 | CCTGGTATACGTCCTTGAATTTC | No data | ||
Right | 1195156990 | X:102133451-102133473 | CTTGAATTTCAGTTGGTACCAGG | No data | ||||
1195156986_1195156990 | 6 | Left | 1195156986 | X:102133422-102133444 | CCAAGGGAGGAAGGGTCCTGGTA | No data | ||
Right | 1195156990 | X:102133451-102133473 | CTTGAATTTCAGTTGGTACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1195156990 | Original CRISPR | CTTGAATTTCAGTTGGTACC AGG | Intergenic | ||