ID: 1195156990 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:102133451-102133473 |
| Sequence | CTTGAATTTCAGTTGGTACC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1195156987_1195156990 | -10 | Left | 1195156987 | X:102133438-102133460 | CCTGGTATACGTCCTTGAATTTC | No data | ||
| Right | 1195156990 | X:102133451-102133473 | CTTGAATTTCAGTTGGTACCAGG | No data | ||||
| 1195156986_1195156990 | 6 | Left | 1195156986 | X:102133422-102133444 | CCAAGGGAGGAAGGGTCCTGGTA | No data | ||
| Right | 1195156990 | X:102133451-102133473 | CTTGAATTTCAGTTGGTACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1195156990 | Original CRISPR | CTTGAATTTCAGTTGGTACC AGG | Intergenic | ||